Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for preparing heterologous protein wrapped polyhedrosis

A technology for exogenous protein and polyhedron, which is applied in the field of preparing polyhedron wrapping exogenous protein, can solve the problems of poor biological activity of recombinant protein, complicated purification process of recombinant protein, difficulty in separation and purification, etc., and achieves high embedding rate , the effect of high expression level and strong resistance

Pending Publication Date: 2022-03-15
SUZHOU UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Existing recombinant proteins mostly exist in the form of inclusion bodies, the purification process of recombinant proteins is complex, separation and purification are difficult, and the biological activity of recombinant proteins is poor, and the safety of products is affected by the presence of a variety of endotoxins in the periplasm

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing heterologous protein wrapped polyhedrosis
  • Method for preparing heterologous protein wrapped polyhedrosis
  • Method for preparing heterologous protein wrapped polyhedrosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1 Construction of polyhedrons embedded with green fluorescent protein

[0054] (1) Routinely extract the total RNA from the midgut tissue infected by silkworm plasmopolyhedrosis virus, use RNA PCR KitVer. The coding sequence of viral polyhedrin gene (GenBank accession number: GQ924589) designed primer polh-EI (GAATTCATGGCAGACGTAGCAGGAACA, with Eco R Restriction site) and polh-XB (TCTAGATCACTGACGGTTACTCAGAGC, with Xba Restriction site), the 5'- and 3'-end bands were amplified by PCR Eco R with Xba The coding sequence of the plastid polyhedrin gene at the locus was cloned into the T-vector, and after sequencing verification, the Eco R with Xba Double-digestion cloned into pFastBac with the same digestion TM Dual, get recombinant transfer plasmid pFastBac TM Dual-Polh;

[0055] (2) According to SEQ ID NO: 1 chemically synthesized with Kpn The MCS-TCS-VP5 sequence of the I site, wherein the MCS sequence contains xho I. Sph I. Nco I....

Embodiment 2

[0066] Example 2 Construction of Polyhedrons Encapsulating Basic Fibroblast Growth Factor

[0067] (1) 0.1mol / L Na for the silkworm plastopolyhedron 2 CO 3 -NaHCO 3 Cleavage at 28°C for 25 minutes, adjust the pH to the isoelectric point of polyhedrin with hydrochloric acid, centrifuge at 12,000 rpm for 10 minutes, and extract the supernatant with phenol, phenol / chloroform (1:1 volume ratio), and chloroform successively. Precipitate RNA with ethanol, and then use RNA PCR KitVer.3.0 (Qiagen Company) to carry out reverse transcription according to the instructions in the product catalog to obtain cDNA, and use the primers (polh-EI, polh-XB) in step (1) of Example 1 to pass PCR Amplify the coding sequence of the plasmoid polyhedrin gene, clone it into a T-vector, and after sequencing verification, use Eco R with Xba Double-digestion cloned into pFastBac with the same digestion TM Dual, get recombinant transfer plasmid pFastBac TM Dual-Polh;

[0068] (2) Same as step ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of immobilized protein, in particular to a method for preparing heterologous protein wrapped polyhedrosis. The bombyx mori cytoplasmic polyhedrosis protein, a fusion foreign protein with a bombyx mori cytoplasmic polyhedrosis virus structural protein VP5 tag and a protease specific cleavage site are co-expressed in bombyx mori culture cells or bombyx mori by using a baculovirus expression system through a genetic engineering method, so that the polyhedrosis wrapping the foreign protein is formed. The formed polyhedron can be purified through simple differential centrifugation; the polyhedrin has protection and slow release effects on foreign proteins wrapped by the polyhedrin. After the purified polyhedrosis is cracked under an alkaline condition, the pH value is adjusted to a polyhedrosis protein isoelectric point by using a hydrochloric acid solution, the polyhedrosis protein can be precipitated through centrifugation, and the fusion foreign protein is retained in a supernatant, so that the fusion foreign protein can be quickly and conveniently obtained; the fusion foreign protein is subjected to enzyme digestion through corresponding protease to remove a VP5 tag, so that a foreign protein closer to the nature can be conveniently obtained.

Description

technical field [0001] The invention relates to the field of viral genetic engineering, in particular to a method for preparing polyhedrons wrapping foreign proteins. Background technique [0002] Drug carriers can change the way the drug enters the body, affect the distribution in the body, control the release rate of the drug, and deliver the drug to the target organ. There are many types of drug carriers, and the more common ones are microcapsules, microspheres, nanoparticles, etc. Among them, microcapsules are drug store-type microcapsules that use polymer materials to wrap solid or liquid drugs; and microspheres refer to drug dispersion. Or a tiny spherical entity formed by being adsorbed in a polymer matrix; nanoparticles generally refer to drug-containing particles of 10-100nm. [0003] Microspheres and microcapsules can increase the local effective concentration of drugs in the body, have sustained release and long-term effect, and improve the stability of drugs, et...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/866C12N15/64C12N15/62C07K19/00A61K47/64C12R1/93
CPCC12N15/86C12N15/62C07K14/005C07K14/503A61K47/64C12N2710/14143C12N2800/105C12N2800/22C07K2319/735C12N2720/12022C07K2319/60C07K2299/00
Inventor 贡成良薛仁宇胡小龙朱敏曹广力张梓瑶冯永杰
Owner SUZHOU UNIV