Method for preparing heterologous protein wrapped polyhedrosis
A technology for exogenous protein and polyhedron, which is applied in the field of preparing polyhedron wrapping exogenous protein, can solve the problems of poor biological activity of recombinant protein, complicated purification process of recombinant protein, difficulty in separation and purification, etc., and achieves high embedding rate , the effect of high expression level and strong resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Example 1 Construction of polyhedrons embedded with green fluorescent protein
[0054] (1) Routinely extract the total RNA from the midgut tissue infected by silkworm plasmopolyhedrosis virus, use RNA PCR KitVer. The coding sequence of viral polyhedrin gene (GenBank accession number: GQ924589) designed primer polh-EI (GAATTCATGGCAGACGTAGCAGGAACA, with Eco R Restriction site) and polh-XB (TCTAGATCACTGACGGTTACTCAGAGC, with Xba Restriction site), the 5'- and 3'-end bands were amplified by PCR Eco R with Xba The coding sequence of the plastid polyhedrin gene at the locus was cloned into the T-vector, and after sequencing verification, the Eco R with Xba Double-digestion cloned into pFastBac with the same digestion TM Dual, get recombinant transfer plasmid pFastBac TM Dual-Polh;
[0055] (2) According to SEQ ID NO: 1 chemically synthesized with Kpn The MCS-TCS-VP5 sequence of the I site, wherein the MCS sequence contains xho I. Sph I. Nco I....
Embodiment 2
[0066] Example 2 Construction of Polyhedrons Encapsulating Basic Fibroblast Growth Factor
[0067] (1) 0.1mol / L Na for the silkworm plastopolyhedron 2 CO 3 -NaHCO 3 Cleavage at 28°C for 25 minutes, adjust the pH to the isoelectric point of polyhedrin with hydrochloric acid, centrifuge at 12,000 rpm for 10 minutes, and extract the supernatant with phenol, phenol / chloroform (1:1 volume ratio), and chloroform successively. Precipitate RNA with ethanol, and then use RNA PCR KitVer.3.0 (Qiagen Company) to carry out reverse transcription according to the instructions in the product catalog to obtain cDNA, and use the primers (polh-EI, polh-XB) in step (1) of Example 1 to pass PCR Amplify the coding sequence of the plasmoid polyhedrin gene, clone it into a T-vector, and after sequencing verification, use Eco R with Xba Double-digestion cloned into pFastBac with the same digestion TM Dual, get recombinant transfer plasmid pFastBac TM Dual-Polh;
[0068] (2) Same as step ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap