Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A method for efficiently extracting intestinal contents and extracellular DNA of earthworms

A content and earthworm technology, which is applied in the field of biotechnology and science, can solve the problems of intestinal content being easily contaminated by body fluids, eDNA extraction in earthworm intestines, complex earthworm intestinal content, etc., and achieves stable and reliable extraction effect. Simple and effective in removing contamination from RNA and protein impurities

Active Publication Date: 2022-05-10
AGRO ENVIRONMENTAL PROTECTION INST OF MIN OF AGRI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the intestinal contents of earthworms are mainly obtained by dissecting the earthworms, but this method is mainly suitable for the larger individuals of Trichos williams, and this method is time-consuming, and the intestinal contents are also easily polluted by body fluids However, there is still a lack of corresponding rapid extraction methods for the rapid acquisition of intestinal contents of individual smaller Eisenia chinensis; in addition, the extraction methods for eDNA in different samples mainly include phenol-chloroform extraction, magnetic bead adsorption method, CTAB extraction method, etc., but these methods are mainly aimed at the extraction of eDNA from tissue, plasma and cultured manure
However, the intestinal contents of earthworms are complex, and earthworm body fluids are seriously disturbed. The existing methods cannot be directly used for the extraction of eDNA in earthworm intestines. Therefore, it is very important to establish a method for rapid acquisition of earthworm intestinal contents and efficient extraction of eDNA.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for efficiently extracting intestinal contents and extracellular DNA of earthworms
  • A method for efficiently extracting intestinal contents and extracellular DNA of earthworms
  • A method for efficiently extracting intestinal contents and extracellular DNA of earthworms

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Example 1 Obtaining the contents of foregut, midgut and hindgut of Eisenia chinensis and extraction of extracellular eDNA.

[0064] Unless otherwise specified, the reagents and consumables used in the following examples are commercially available.

[0065] 1. Collection of Fresh Mature Earthworms

[0066] Samples of fresh and mature Eisenia chinensis with reproductive rings were collected in Tianjin Zhongtao Earthworm Breeding Professional Cooperative, and the individual weight of the earthworm was 0.3-0.5 g. In order to prevent the natural defecation of earthworms during transportation from affecting the content of intestinal contents, it needs to be collected together with part of the earthworm bed matrix and placed in the earthworm breeding box together.

[0067] 2. Rapid Acquisition of Gut Contents of Earthworms

[0068] Rapid acquisition of intestinal contents of earthworms: First, select mature fresh adult Eisenia spp. with reproductive rings from the worm bed, ...

Embodiment 2

[0087] Example 2: Detection of extraction efficiency of extracellular DNA in earthworm gut contents by PCR amplification

[0088]In Example 2, for the primer sequence of the 16S rRNA gene, its upstream primer: 5'-CGGTGAATACGTTCYCGG-3', the downstream primer: 5'-GGWTACCTTGTTACGACTT-3'; for the primer sequence of the zSSIIb internal standard gene, its upstream primer: 5'-CTCCCAATCCTTTGACATCTGC-3', downstream primer: 5'-TCGATTTCTCTCTTGGTGACAGG-3'; for the primer sequence of gfp gene, its upstream primer: 5'-TCCGTTCAACTAGCAGACCAT-3', downstream primer: 5'- TCATCCATGCCATGTGTAATCC -3'; 16S The lengths of amplified fragments of rRNA gene, zSSIIb and gfp internal standard gene were 126bp, 151bp and 182bp, respectively.

[0089] The general PCR amplification reaction system in Example 2 is 25 μL amplification system, and the qualitative PCR amplification reaction system is shown in Table 3.

[0090] Table 3 Qualitative PCR reaction system

[0091] composition Volume (μL) ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for efficiently extracting earthworm gut content and its extracellular DNA. The steps are as follows: rapid acquisition of earthworm gut content; construction and preparation of the extracellular genome internal standard gene; Extra DNA extraction. On the one hand, the method of the present invention can quickly take out the intestinal contents of individual tiny Eisenia chinensis, with simple steps and short time-consuming; on the other hand, it can also effectively separate and purify the extracellular eDNA in the intestinal contents, The extraction effect is stable, reliable and repeatable, and the extraction efficiency can reach 61%. The OD260 / OD280 of the extracted eDNA can reach 1.63, and the OD260 / OD230 can reach 1.72 through the detection of a nucleic acid protein analyzer, and subsequent molecular operations can be performed. The extraction method of the invention greatly improves the extraction quality of the intestinal content of the earthworm, and lays a foundation for the subsequent research on the extracellular genetic material of the earthworm intestinal tract.

Description

technical field [0001] The invention belongs to the field of biotechnology science and technology, in particular to a method for efficiently extracting earthworm intestinal contents and extracellular DNA. Background technique [0002] Earthworm transformation is an emerging technology for high-value and efficient resource utilization of livestock and poultry manure. This technology not only has high treatment efficiency, but also can turn waste into treasure and realize green environmental protection, which has attracted increasing attention. However, due to the long-term use of low-dose antibiotics in the breeding process, a large number of antibiotic-resistant bacteria (Antibiotic resistance bacteria, ARB) and antibiotic resistance genes (Antibiotic Resistance Genes, ARGs) have appeared in livestock and poultry manure, and the current pollution situation is very serious. severe. If left untreated, ARGs in livestock and poultry manure may be enriched in earthworms or remai...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/10C12Q1/6806C12N15/70C12N15/65C12N15/63C12N15/54C12N1/21C12R1/19
Inventor 杨凤霞张克强杨鹏丁永祯田雪力韩秉君
Owner AGRO ENVIRONMENTAL PROTECTION INST OF MIN OF AGRI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products