A method for efficiently extracting intestinal contents and extracellular DNA of earthworms
A content and earthworm technology, which is applied in the field of biotechnology and science, can solve the problems of intestinal content being easily contaminated by body fluids, eDNA extraction in earthworm intestines, complex earthworm intestinal content, etc., and achieves stable and reliable extraction effect. Simple and effective in removing contamination from RNA and protein impurities
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0063] Example 1 Obtaining the contents of foregut, midgut and hindgut of Eisenia chinensis and extraction of extracellular eDNA.
[0064] Unless otherwise specified, the reagents and consumables used in the following examples are commercially available.
[0065] 1. Collection of Fresh Mature Earthworms
[0066] Samples of fresh and mature Eisenia chinensis with reproductive rings were collected in Tianjin Zhongtao Earthworm Breeding Professional Cooperative, and the individual weight of the earthworm was 0.3-0.5 g. In order to prevent the natural defecation of earthworms during transportation from affecting the content of intestinal contents, it needs to be collected together with part of the earthworm bed matrix and placed in the earthworm breeding box together.
[0067] 2. Rapid Acquisition of Gut Contents of Earthworms
[0068] Rapid acquisition of intestinal contents of earthworms: First, select mature fresh adult Eisenia spp. with reproductive rings from the worm bed, ...
Embodiment 2
[0087] Example 2: Detection of extraction efficiency of extracellular DNA in earthworm gut contents by PCR amplification
[0088]In Example 2, for the primer sequence of the 16S rRNA gene, its upstream primer: 5'-CGGTGAATACGTTCYCGG-3', the downstream primer: 5'-GGWTACCTTGTTACGACTT-3'; for the primer sequence of the zSSIIb internal standard gene, its upstream primer: 5'-CTCCCAATCCTTTGACATCTGC-3', downstream primer: 5'-TCGATTTCTCTCTTGGTGACAGG-3'; for the primer sequence of gfp gene, its upstream primer: 5'-TCCGTTCAACTAGCAGACCAT-3', downstream primer: 5'- TCATCCATGCCATGTGTAATCC -3'; 16S The lengths of amplified fragments of rRNA gene, zSSIIb and gfp internal standard gene were 126bp, 151bp and 182bp, respectively.
[0089] The general PCR amplification reaction system in Example 2 is 25 μL amplification system, and the qualitative PCR amplification reaction system is shown in Table 3.
[0090] Table 3 Qualitative PCR reaction system
[0091] composition Volume (μL) ...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com