Biological fermentation preparation method of semaglutide core peptide chain

A bio-fermentation and peptide chain technology, which is applied in the field of preparation of semaglutide core peptide chain, can solve the problems of high cost of preparation route and high price of endonuclease market, and achieve the effect of convenient purification, less impurities and lower difficulty

Pending Publication Date: 2022-05-10
JIANGSU ALPHA PHARM CO LTD
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because this method requires additional commercially available endonucleases to carry out enzyme digestion to obtain the target polypeptide Lys 26 Arg 34 GLP-1(10-37), the current market price of endonuclease is very expensive, resulting in higher cost of this preparation route

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biological fermentation preparation method of semaglutide core peptide chain
  • Biological fermentation preparation method of semaglutide core peptide chain
  • Biological fermentation preparation method of semaglutide core peptide chain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] The DNA sequence synthesis of embodiment 1 fusion protein A1 and the construction of plasmid

[0028] Total synthesis of TEVp 238△mutant-Lys by Shanghai Jierui Biotechnology Co., Ltd. 26 Arg 34 GLP-1(10-37) DNA sequence, add His tag to the N-terminus of the sequence, add TGA to the C-terminus, design primer F: CATATG CATCATCATCATCATCATGGCGAATCTCTGT,R: CTCGAG TTAGCCCCACGACCACGCA (as shown in SEQ ID NO: 6-7), and link the target sequence to the vector, the fusion protein sequence is shown in SEQ ID NO: 1, and its structure is shown in figure 2 , constructed to express His tag-TEVp238△mutant-TEV protease site-Lys 26 Arg 34 The recombinant fusion expression vector of GLP-1(10-37), such as figure 1 shown. Among them, TEVp 238△mutant is one of the TEVp mutants.

Embodiment 2

[0029] Embodiment 2 Expression Engineering Bacteria Preparation and Positive Verification

[0030] After the recombinant expression vector in Example 1 was validated by gel running, it was transformed into E.coli BL21 competent medium, positive colonies were screened out by Km antibiotics, full and positive colonies were selected, and DNA sequencing verification was carried out after expansion, and after confirmation, proceed Glycerol bacteria preservation.

Embodiment 3

[0031] Embodiment 3 Expression of fusion protein A1

[0032] The preserved recombinant strains were fermented in a 15L fermenter and cultivated to OD at 37°C 600 At 20 o'clock, IPTG was added for induction, the amount of IPTG added was 0.2mM, and the strain OD was detected at 0h after induction 600 , induced to OD 600 If the increase is not obvious, put it into the tank, centrifuge at 6000rpm for 10min, and collect the bacteria.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biological engineering, in particular to a biological fermentation preparation method of a semaglutide core peptide chain, and the core peptide chain is Lys26Arg34GLP-1 (9-37), Lys26Arg34GLP-1 (10-37) or Lys26Arg34GLP-1 (11-37). The specific method comprises the following steps: coupling a core peptide chain with an incision enzyme or a mutant thereof required by the fusion protein to obtain a fusion protein DNA sequence, then constructing an expression vector of the fusion protein, loading an expression cell, expressing the fusion protein to obtain an inclusion body, and carrying out renaturation purification and enzyme digestion to obtain a product. Compared with simultaneous enzyme digestion and renaturation, the method has the advantages of no need of additional addition of incision enzyme, low cost, economy, high efficiency and environmental friendliness.

Description

technical field [0001] The invention relates to the technical field of bioengineering, in particular to a method for preparing a semaglutide core peptide chain. Background technique [0002] Diabetes mellitus is a metabolic disease characterized by chronic elevated blood sugar, which is a progressive disease caused by the decline of pancreatic β-cell function and insulin resistance. Deficiency of insulin secretion by pancreatic β cells and inappropriate secretion of glucagon by α cells are important reasons for the imbalance of insulin and glucagon in patients with type 2 diabetes. [0003] The original research company of semaglutide is Novo Nordisk. As the most concerned diabetes drug, semaglutide is the seventh approved GLP-1 receptor agonist in the world. According to the 53rd session on September 12, 2017 The results of a post-hoc analysis of SUSTAIN 1-5 studies published at the European Association for the Study of Diabetes (EASD2017) showed that patients with type 2 ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/70C12N15/62C12N1/21C12R1/19
CPCC12N15/70C07K14/605C07K2319/21C07K2319/50
Inventor陈本顺李大伟徐春涛何伟尹强张维冰邱磊江涛尹斌
OwnerJIANGSU ALPHA PHARM CO LTD