Unlock instant, AI-driven research and patent intelligence for your innovation.

Trichoderma reesei mutant strain with high yield of rhamnosidase and application of trichoderma reesei mutant strain

A technology of rhamnosidase and Trichoderma reesei, applied in the direction of glycosylase, mutant preparation, enzyme, etc., to achieve the effect of reducing production cost

Pending Publication Date: 2022-06-10
青岛蔚蓝康成生物科技有限公司 +1
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it is difficult to extract, separate and purify α-L-rhamnosidase in large quantities no matter from plant or animal tissues, so it is difficult to realize the industrialization of production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Trichoderma reesei mutant strain with high yield of rhamnosidase and application of trichoderma reesei mutant strain
  • Trichoderma reesei mutant strain with high yield of rhamnosidase and application of trichoderma reesei mutant strain
  • Trichoderma reesei mutant strain with high yield of rhamnosidase and application of trichoderma reesei mutant strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Using the ACU genome of Aspergillus aculeatus as a template, primers 1 and 2 were used to amplify the rhamnosidase gene fragment, the nucleotide sequence of which is SEQ ID NO: 2, and the encoded amino acid sequence is SEQ ID NO :1.

[0026] PCR primers and reaction conditions are as follows:

[0027] Primer 1 (F): ATGCACATTATCACTCCTTTGCT;

[0028] Primer 2 (R): TCAGTCGGCTGACTCAATCAGCT.

[0029] The reaction conditions were: denaturation at 94°C for 5 minutes; then denaturation at 94°C for 30 s, renaturation at 56°C for 30 s, extension at 72°C for 120 s, and after 30 cycles, incubation at 72°C for 10 min. The results of agarose electrophoresis showed that the size of the amplified rhamnosidase gene was 1968bp.

[0030] The construction of embodiment 2 recombinant expression vector

Embodiment 2

[0031] The above-mentioned rhamnosidase gene was amplified by PCR, and XbaI sites were introduced at both ends of the primers. The primer sequences are as follows:

[0032] Primer 3 (F): GC TCTAGA ATGCACATTATCACTCCTTTGCT;

[0033] Primer 4 (R): GC TCTAGA TCAGTCGGCTGACTCAATCAGCT.

[0034] The PCR reaction conditions were as follows: denaturation at 94°C for 5 minutes; then denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 120 s, and after 30 cycles, incubation at 72°C for 10 min. The results of agarose gel electrophoresis showed that the rhamnosidase gene was a fragment with a size of 1968bp.

[0035] The rhamnosidase gene fragment obtained above and the expression vector pTG were subjected to single digestion with restriction endonuclease XbaI respectively, and the digestion conditions were as follows:

[0036]

[0037] Enzyme digestion treatment in water bath at 37°C for 2 hours, after electrophoresis, two target fragments were recov...

Embodiment 3

[0041] 1. Protoplast preparation:

[0042] Inoculate Trichoderma reesei host bacterium 4Q on PDA+U (potato 200g / L, filter after boiling for 20-30min to remove slag; glucose 2%; Uridine 1%; agar powder 1.5%), cultivate at 30°C for 5-7d; Take a 2cm×2cm sized bacterial block, inoculate 100ml of liquid PDA+U (potato 200g / L, boil for 20-30min and filter to remove residue; glucose 2%; Uridine 1%) medium, culture at 30°C for 16h to grow mycelium For transformation; after filtering the grown mycelia, resuspend with 20ml of 1.2M magnesium sulfate solution; add 0.2g lysozyme, culture at 30°C, 100rpm for 2-3h; wipe the cracked mycelium with 2 layers Filter through paper and centrifuge at 3000rpm for 10 minutes to obtain protoplasts; filter the lysed mycelium with lens paper and centrifuge to obtain protoplasts; then resuspend with an appropriate amount of sorbitol solution.

[0043] 2. Conversion:

[0044] The Trichoderma reesei 4Q protoplast obtained above was washed 2 times with 1.2M...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of gene engineering, and particularly provides a trichoderma reesei mutant strain with high yield of rhamnosidase and application of the trichoderma reesei mutant strain. According to the present invention, the rhamnosidase gene derived from Aspergillus aculeatus is subjected to overexpression in the Trichoderma reesei host so as to construct and obtain the gene engineering strain for recombinant expression of the rhamnosidase, and then the mutant strain with the rhamnosidase yield significantly improved is further screened through the ultraviolet mutagenesis method, and the preservation number is CCTCC NO: M2020700; the mutant strain can be widely applied to the production of rhamnosidase and is beneficial to reducing the production cost of the rhamnosidase.

Description

technical field [0001] The invention relates to the technical field of genetic engineering and microbial transformation, and specifically relates to a mutant strain of Trichoderma reesei with high rhamnosidase production and application thereof. technical background [0002] Flavonoids are compounds with 2-phenylchromone as the core and C6-C3-C6 as the basic skeleton. Flavonoids have multiple phenolic hydroxyl groups, which have the functions of scavenging free radicals, anti-oxidation, antibacterial, anti-viral, and anti-inflammatory. Inflammation, anti-tumor and other pharmacological activities. However, flavonoid glycosides generally have low water solubility and low utilization efficiency. At present, deglycosylation can be used to modify the structure of flavonoids. When the terminal rhamnoside of flavonoid glycosides is hydrolyzed, its water solubility is greatly increased, its utilization efficiency is high, and its pharmacological activity can be greatly improved. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/15C12N15/01C12N13/00C12N9/24C12R1/885
CPCC12N9/2402C12N15/01C12N13/00C12Y302/0104
Inventor 徐晓东李瑞
Owner 青岛蔚蓝康成生物科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More