Trichoderma reesei mutant strain with high yield of rhamnosidase and application of trichoderma reesei mutant strain
A technology of rhamnosidase and Trichoderma reesei, applied in the direction of glycosylase, mutant preparation, enzyme, etc., to achieve the effect of reducing production cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Using the ACU genome of Aspergillus aculeatus as a template, primers 1 and 2 were used to amplify the rhamnosidase gene fragment, the nucleotide sequence of which is SEQ ID NO: 2, and the encoded amino acid sequence is SEQ ID NO :1.
[0026] PCR primers and reaction conditions are as follows:
[0027] Primer 1 (F): ATGCACATTATCACTCCTTTGCT;
[0028] Primer 2 (R): TCAGTCGGCTGACTCAATCAGCT.
[0029] The reaction conditions were: denaturation at 94°C for 5 minutes; then denaturation at 94°C for 30 s, renaturation at 56°C for 30 s, extension at 72°C for 120 s, and after 30 cycles, incubation at 72°C for 10 min. The results of agarose electrophoresis showed that the size of the amplified rhamnosidase gene was 1968bp.
[0030] The construction of embodiment 2 recombinant expression vector
Embodiment 2
[0031] The above-mentioned rhamnosidase gene was amplified by PCR, and XbaI sites were introduced at both ends of the primers. The primer sequences are as follows:
[0032] Primer 3 (F): GC TCTAGA ATGCACATTATCACTCCTTTGCT;
[0033] Primer 4 (R): GC TCTAGA TCAGTCGGCTGACTCAATCAGCT.
[0034] The PCR reaction conditions were as follows: denaturation at 94°C for 5 minutes; then denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 120 s, and after 30 cycles, incubation at 72°C for 10 min. The results of agarose gel electrophoresis showed that the rhamnosidase gene was a fragment with a size of 1968bp.
[0035] The rhamnosidase gene fragment obtained above and the expression vector pTG were subjected to single digestion with restriction endonuclease XbaI respectively, and the digestion conditions were as follows:
[0036]
[0037] Enzyme digestion treatment in water bath at 37°C for 2 hours, after electrophoresis, two target fragments were recov...
Embodiment 3
[0041] 1. Protoplast preparation:
[0042] Inoculate Trichoderma reesei host bacterium 4Q on PDA+U (potato 200g / L, filter after boiling for 20-30min to remove slag; glucose 2%; Uridine 1%; agar powder 1.5%), cultivate at 30°C for 5-7d; Take a 2cm×2cm sized bacterial block, inoculate 100ml of liquid PDA+U (potato 200g / L, boil for 20-30min and filter to remove residue; glucose 2%; Uridine 1%) medium, culture at 30°C for 16h to grow mycelium For transformation; after filtering the grown mycelia, resuspend with 20ml of 1.2M magnesium sulfate solution; add 0.2g lysozyme, culture at 30°C, 100rpm for 2-3h; wipe the cracked mycelium with 2 layers Filter through paper and centrifuge at 3000rpm for 10 minutes to obtain protoplasts; filter the lysed mycelium with lens paper and centrifuge to obtain protoplasts; then resuspend with an appropriate amount of sorbitol solution.
[0043] 2. Conversion:
[0044] The Trichoderma reesei 4Q protoplast obtained above was washed 2 times with 1.2M...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com