Glucosyltransferase mutant and application thereof
A technology of glucosyltransferase and mutants, which is applied in the field of protein engineering, can solve problems such as unfavorable promotion and application, and affect costs, and achieve the effects of reducing production costs, improving production efficiency, thermal stability and enzyme activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1 Prediction and analysis of the protein structure of UDP-glucosyltransferase
[0033] The wild-type amino acid sequence (shown in SEQ ID NO. 1) was used to model the protein structure using the RoseTTAFold2 online prediction software ( figure 2 ), and use the online analysis tool Procheck to analyze the reliability of the model. The Laplace conformation diagram is shown in image 3 shown. The red area is the high confidence area, 90.1% of the amino acids in the model fall in this area; the dark yellow area is the high tolerance area, 7.8% of the amino acids fall in this area; 1% of the amino acids fall in the light yellow low tolerance area. Only four amino acids (1%) are white forbidden regions. A high proportion of amino acids are located in the red and dark yellow regions, indicating that the model is of high quality and can be used for subsequent analysis studies.
Embodiment 2
[0034] Example 2 Construction of site-directed mutant library of predicted sites
[0035]The site-directed mutagenesis prediction analysis of the improved thermal stability of the three-dimensional structure obtained in Example 1 was carried out using the FireProt online prediction website. Based on the change in binding energy, the mutation sites (Table 1) were determined to be A11L, S58G, V304L, S55P, F39Y, T329I, A250E, N109K, I279L. The UDP-glucosyltransferase gene (as shown in SEQ ID NO. 2) derived from ginseng was connected to the pET30a(+) vector through EcoRI and NotI to obtain the recombinant expression vector pET30a-PU. Primers were designed for site-directed mutagenesis on pET30a-PU (Table 2).
[0036] Table 1 Prediction of changes in binding energy at mutation sites
[0037]
[0038]
[0039] Table 2 Primer sequences
[0040] primer name Primer sequence (5'-3') A11L-F AATCAGTATACTGTTGCTACCATTTTTAGC A11L-R CAGTATACTGATTCTACCAT ...
Embodiment 3
[0041] Example 3 E. coli expression of site-directed mutagenesis enzymes
[0042] The point mutation recombinant expression vector constructed in Example 2 was transformed into the expression host Escherichia coli BL21 (DE3) and spread on LB kanamycin plate. The successfully identified positive transformants were inoculated into 10 mL LB medium (containing 50 mg / L kanamycin antibiotic) for overnight culture at 37°C. The next day, the seed solution was transferred to 100 mL of LB medium (containing 50 mg / L kanamycin antibiotic) at a ratio of 2% v / v, and cultured at 37°C to OD. 600 0.6-0.8, add the inducer isopropyl-β-D-thiogalactoside (IPTG, 5mM), and culture at 16°C for 26h. The cultured cells were collected by centrifugation at 7000 rpm at 4°C and washed twice. The bacterial cells were disrupted by sonication, and the crude enzyme solution was obtained by centrifugation at 10,000 rpm for 30 min at 4°C. The crude enzyme solution was purified by nickel ion affinity chromatog...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More