Hypothetical protein gene, primer probe group thereof and application of hypothetical protein gene and primer probe group in detection of Meiqi yeast two sharp

A technology of primer probe and hypothetical protein, which is applied in the field of quantitative detection of bicuspid meschis yeast, can solve problems such as not being able to meet production requirements, and achieve the effects of high sensitivity, strong specificity, and high detection accuracy

Inactive Publication Date: 2022-07-29
天津市水产研究所
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, only by PCR detection method to determine whether the Chinese mitten crab carries Metschnix bitipii cannot meet the production needs, and it is necessary to carry out quantitative detection of pathogens and further improve the detection sensitivity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hypothetical protein gene, primer probe group thereof and application of hypothetical protein gene and primer probe group in detection of Meiqi yeast two sharp
  • Hypothetical protein gene, primer probe group thereof and application of hypothetical protein gene and primer probe group in detection of Meiqi yeast two sharp
  • Hypothetical protein gene, primer probe group thereof and application of hypothetical protein gene and primer probe group in detection of Meiqi yeast two sharp

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] The gene fragment (shown as SEQ ID NO. 1) for detecting M. bicides provided by the present invention is derived from the hypothetical protein gene of M. bicides, and the nucleotide sequence of the hypothetical protein gene is as shown in SEQ ID NO. 2 shown. Through the whole genome alignment, it was found that the hypothetical protein gene is a unique gene of M. biloba, so the gene and its gene fragment can be used as a specific detection fragment to distinguish M. michelia from other strains. It is of great significance to improve the specificity and sensitivity of the detection of M. bicides.

[0020] Use the software Primer Primer 5.0 to design specific primers for the hypothetical protein gene (synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.) of M. bicides, marked as:

[0021] HP-F: AAACCCGCAAACTCCACAGA;

[0022] HP-R: TGGATATCACGCTCCATCATTT.

[0023] The strain of M. biloba JMB-1 was cultivated, and total DNA was extracted with a yeast genome extractio...

Embodiment 2

[0025] Using the formula copies / μL=(ng / μL×10 -9 )×(6.02×10 23 ) / (DNA length×660), convert the mass concentration to the copy number concentration according to the molecular weight of the recombinant plasmid standard, and then use sterile water (ddH 2 O) Dilute the recombinant plasmid standard 10-fold serially, and then dilute to 1.13×10 9 Copy / μL~1.13×10 1 copies / μL, a total of 9 concentration gradients.

[0026] Using the serially diluted recombinant plasmid samples as templates, HP-F and HP-R as primers, and HP-TaqMan:FAM-AAATCCACAATACATTGAAGAGCAGCGCA-BHQ1 as probes, real-time quantitative PCR was performed.

[0027] The reaction system of real-time fluorescence quantitative PCR is: 2×Premix Ex Taq (Probe qPCR) 10 μL, upstream detection primer (HP-F) 1 μL, downstream detection primer (HP-R) 1 μL, probe (HP-TaqMan) 0.8 μL, Template 2 μL, sterile water 5.2 μL.

[0028] The amplification procedure was as follows: denaturation at 95°C for 20s; denaturation at 95°C for 1s, a...

Embodiment 3

[0031] M. biloba, M. lakoffii, Saccharomyces cerevisiae, Candida tropicalis, Saccharomyces niger, Pichia kudzu, Saccharomyces aureus, Rhododendron, Rhododendron, Hansenula Debaryomyces, Vibrio alginolyticus, Vibrio harveii, Flavobacterium columnar, Streptococcus agalactiae, Streptococcus dysgalactiae, Vibrio eel, Vibrio parahaemolyticus, Photobacterium mermaidii, Aeromonas hydrophila, Aeromonas mildew, Aeromonas viridis, Bacillus cereus, Vibrio vulnificus, Mycobacterium marinum, Nocardia amberjack, Edwardsiella lentus were individually cultured, and DNA extraction kits (purchased from Bao Bioengineering (Dalian) Co., Ltd.) extracted its DNA as a template, and used nuclease-free water (RNase-Free ddH2O) as a negative control, using the primers and probe sets shown in SEQ ID NO. PCR.

[0032] The result is as image 3 As shown, only the samples templated with M. michelia DNA had significant amplification curves. There are no obvious peaks in other bacteria and the negative co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
PCR efficiencyaaaaaaaaaa
Login to View More

Abstract

The invention provides a hypothetical protein gene, a primer probe group thereof and application of the hypothetical protein gene to detection of metschinia dicuspidata, and belongs to the technical field of quantitative detection of the metschinia dicuspidata. The nucleotide sequence of the gene segment used for detecting the metschhia pastoris is as shown in SEQ ID NO.1, the nucleotide sequence of the hypothetical protein gene containing the gene segment is as shown in SEQ ID NO.2, and the primer probe group used for amplifying the gene segment is as shown in SEQ ID NO.3-5. The gene segment and the primer probe group for detecting the Meiqi yeast two-pointed, provided by the invention, have the advantages of high sensitivity, strong specificity and high detection accuracy, can be used for quantitatively detecting the quantity of the Meiqi yeast two-pointed carried in river crabs, and have important significance on prevention and control of diseases caused by the Meiqi yeast two-pointed.

Description

technical field [0001] The invention relates to the technical field of quantitative detection of M. bicides, in particular to a hypothetical protein gene, a primer probe set thereof, and an application for detecting M. bicides. Background technique [0002] Chinese mitten crab, commonly known as river crab, is one of the important freshwater aquaculture species in my country. In recent years, my country has vigorously promoted the comprehensive cultivation of rice and fishery, in order to achieve the purpose of "two uses for one water, two harvests for one field, and a win-win situation for rice and fishery". As the most suitable species for rice field farming in northern regions, river crab is developing rapidly. With the increase of the breeding scale, the diseases have gradually increased. Since 2018, a new disease has appeared in the Chinese mitten crabs cultivated in the main producing areas of river crabs in the northern region. A milky liquid that farmers call "milk...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6895C12N15/11C12Q1/6851C12R1/645
CPCC12Q1/6895C07K14/39C12R2001/645Y02A50/30
Inventor徐晓丽刘厚孚罗璋李媛媛张连英蔡琰
Owner天津市水产研究所