G-type lysozyme gene of Argopecten irradians and encoded protein and cloning method thereof
A kind of cloning method, the technique of gene coding, applied in the field of G-type lysozyme
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0016] Embodiment 1. A cloned bay scallop G-type lysozyme gene has the following sequence:
[0017] (1) Information of SEQ ID NO.1 in the sequence listing
[0018] sequence features
[0019] Length: 659 bp
[0020] Type: nucleic acid
[0021] Chain type: double chain
[0022] Topology: Linear
[0023] Source: Bay Scallops (Argopecten irradians)
[0024] Sequence description:
[0025] GACGAGGCTGATTTGACAATGAATGCCCTAGTGGTTATAACGCTTCTT
[0026] GCTTTCAGCACTGGCGCCTGGGCAGCGTCCTACACGTGCCATGGTGA
[0027] CGTCAGGCGTCTTCATCCAACCGGAGAGCACAACGGAGGTAACGCTG
[0028] CCTCTCATAACGATGTTAAATATGACTACAACGACCTCCTTAACAAGA
[0029] AGTCTTGTTACGACCAGGCTGGAGCCACTTACTGTATCCAACCATCGG
[0030] TGATCGCTGCCTTAGCCAGCCGTGAGTCACGTGGTGGTCGCCTGTTGC
[0031] ATTCAACCAATGGATGGGGAGACCATCACCATGCTTACGGAATTTTAC
[0032] AGTGTGACATCCGTTACCACAGCTGTACCCAGCACGCATGGGACAGC
[0033] TGTGCACACATTTCCCAGATGGTTCAAAGAAGTCCTAGTGCCCTACATC
[0034] AATCAGGTGGCCCACAAAACATCCCACATGGTCAAAGGAGCAACAACT
[0035] CCTAGGTGGAA...
Embodiment 2
[0052] Embodiment 2. Cloning method of bay scallop G-type lysozyme gene
[0053]1) Extraction of total RNA from bay scallops and purification of mRNA: Collect hemolymph from the adductor muscle of bay scallops infected with Vibrio anguillarum with a syringe, centrifuge at 700g at 4°C for 10 minutes, use Trizol reagent from Invitrogen Company and refer to its instructions Total RNA was extracted from the hemolymph of bay scallops infected with Vibrio anguillarum, and the mRNA was purified using the Oligotex mRNA purification kit from QIAGENE;
[0054] 2) Gulf scallop cDNA library construction: use Stratatagene company cDNA Synthesis Kit and ZAP-cDNA Synthesis Kit (Stratagene) and refer to the instructions for use to carry out cDNA synthesis. After cleavage with Xho I endonuclease, QIAEX II Agarose Gel Extraction Kit from QIAGEN Company was used to recover the digested fragments larger than 100 bp, connected to the Uni-ZAP XR vector carrier of Invetrogen Company, and ZAP-cDNA® G...
Embodiment 3
[0062] Example 3. The application of the sequence of the bay scallop G-type lysozyme gene in the genetic selection of bay scallop
[0063] According to the sequence of SEQ ID NO.1 in the sequence table in Example 1, PCR and RT-PCR primers were designed to amplify and sequence the partial sequences of the G-type lysozyme genes of different individuals of the bay scallop, and compare different individuals in the G-type lysozyme gene. The difference in the enzyme gene sequence; at the same time, the difference in the expression level of the G-type lysozyme gene mRNA in different individuals was compared to guide the genetic selection of bay scallops.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com