Human proinsulin-KGD chimeric peptide as new recombinat antithrombotic with thrombocyte GP-IIb-IIIa receptor specificity
A technology of human insulin and chimeric peptides, which is applied in the direction of carrier binding/immobilizing peptides, medical preparations containing active ingredients, hybrid peptides, etc., to achieve the effects of no pollution to the environment, simple purification process, and high anti-platelet aggregation inhibitory activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Embodiment 1. Construction of human proinsulin-KGD chimeric peptide gene
[0028] Experimental Materials:
[0029] Strains: E.coli DH5α, BL21(DE3)pLysS, JM109 are all commercially available products.
[0030] Primers: DNA fragments of oligonucleotide primers were synthesized by Beijing Saibaisheng Company. Primer 1: 5'CCCAAGCTTGAATTCACATG A3'; Primer 2: 5'GAAGAAGCGGCTTTAGCCAGCTTCCCTTTGCCCACCTGCACATA3'; Primer 3: 5'CATAAGCCGCTGTC 3'; Primer 4: 5'GTGGCGCTGATCACCC3'.
[0031] Chemical reagents and enzymes: common restriction enzymes, T4 DNA ligase, Klenow fragment, T4 DNA polymerase, T4 polynucleotide kinase, Taq DNA polymerase, RNase, ATP, dNTPs, IPTG, TEMED, etc. were purchased from Promega , Huami Biotechnology Corporation or Takara Biotechnology Corporation. pET21a vector was purchased from Novagen, USA. DNA wizard plus Miniprep DNA purification system was purchased from Promega. Ultra-pure urea, acrylamide, methylene bisacrylamide and Tris are...
Embodiment 2
[0040] Example 2. Expression and purification of human proinsulin-KGD chimeric peptide mutant in Escherichia coli expression system
[0041] The Escherichia coli expression strain with recombinant mutant gene was fermented and cultured. When the bacterial growth in the culture solution reaches the logarithmic phase, IPTG is added to induce the expression of the gene, and the expression time is 5-7 hours. Then, the wet bacterial cells fermented and cultured were collected and centrifuged. Suspend the above-mentioned fermented bacteria in STET solution, ultrasonically disrupt E. coli, etc., centrifuge the treated solution at 10,000g, 4°C, 10 minutes, collect the precipitate after centrifugation, and dissolve the precipitate with inclusion body lysate, 4 Stir overnight at ℃, add dithiothreitol to the solution to a final concentration of 15-20mM, let it stand at room temperature for 2 hours, expand the total volume of the solution with 5 times the volume of pre-cooled water, a...
Embodiment 3
[0042] Example 3. Research on important physicochemical properties of human proinsulin-KGD chimeric peptide
[0043] 1. Determination of molecular weight
[0044] The mass spectrometry detection experiment was completed by the mass spectrometry laboratory of the Analysis and Testing Center of Beijing Academy of Military Medical Sciences. For specific steps, refer to the product instruction manual of the mass spectrometer of the United States HP company and the instruction manual of the detection software package. The results are attached Figure 4 shown. The measured molecular weight of human proinsulin-KGD chimeric peptide is 6303Dalton, compared with its theoretically calculated value (MW=6322Dalton), the error is 0.3%, which is within the allowable error range of mass spectrometry, which proves that the measurement result is true and reliable. The measurement results showed that the purified product of human proinsulin-KGD chimeric peptide recombinant protei...
PUM
Property | Measurement | Unit |
---|---|---|
Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com