Test paper strip for rapidly detecting brucellosis antibody
A technique for detection of brucella and test strips, applied in the preparation of the bp26 genetic engineering antigen of the outer membrane protein of brucella, and the field of rapid detection of brucella antibodies History, occupation, eating habits, living area and endemic area, lack of simple, fast, specific and sensitive detection methods, insufficient awareness of brucellosis, etc., to save manpower and material resources, easy to promote, easy to store and transport
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Embodiment 1: the preparation of Brucella outer membrane protein bp26 genetic engineering antigen
[0034] (1) Obtaining the target gene
[0035] According to the sequence of the target gene fragment (GenBank accession number is AY166769) and the characteristics of the pGEX-4T-1 (Pharmacia) expression vector, primers containing restriction enzymes EcoR1 and Xho1 restriction sites at both ends were designed:
[0036] 5'gaattcatgaacactcgtgct 3'
[0037] 5' gcctcgagttacttgatttcaa 3'
[0038] Then, the target gene fragment bp26 was amplified from the Brucella genome. The amplification conditions were: denaturation at 95°C for 5 minutes; 1 minute at 95°C, 1 minute at 49.8°C, and 1 minute at 70°C for 35 cycles; finally, extension at 70°C for 10 minutes.
[0039] (2) Cloning of the target gene and screening of positive recombinants
[0040] After electrophoresis, the PCR amplified product was recovered by gel cutting, ligated with the PMD-18T cloning vector overnight at 16°...
Embodiment 2
[0049] Example 2: Preparation of polyclonal antibody against outer membrane protein bp26
[0050] (1) Animal immunity:
[0051] Select 1-2kg New Zealand white rabbits, and inject bp26 protein subcutaneously in multiple points on the back, and the immunization dose is 1mg / kg. A total of 4 times of immunization.
[0052] (2) Immunological titer detection:
[0053] ELISA plate coated with bp26 protein, 4 μg per well. The titer of immune serum was detected by indirect ELISA method. When the serum titer reaches 1:20000 or more, the serum can be collected.
[0054] (3) Antibody purification and verification:
[0055] Purification by conventional octanoic acid method. The purity was tested by non-denaturing PAGE electrophoresis, showing a protein band. The activity was tested by ELISA, and the titer was greater than 1:20000.
Embodiment 3
[0056] Embodiment 3: the development of Brucella antibody detection kit
[0057] (1) Preparation of colloidal gold-antigen conjugate:
[0058] It was determined by experiments that when bp26 protein was used as the gold-labeled antigen, the optimal binding pH value was 8.0, and the protein ratio was 46 μg / ml colloidal gold. After the labeled colloidal gold is treated with a stabilizer (0.5% BSA, pH8.0, 0.01M Tris buffer), take the colloidal gold-antigen conjugate solution in an amount of 65 μl per square centimeter, evenly adsorb it on the glass fiber, and freeze-dry it. , and stored in a dry environment.
[0059] (2) Coating antigen on nitrocellulose membrane:
[0060] The Brucella outer membrane protein bp26 was diluted to 3.5 ± 0.1 mg / ml with 0.01 M PBS. Dilute goat anti-mouse IgG polyclonal antibody to 2±0.1mg / ml with 0.01M PBS. Spray the two on the nitrocellulose membrane at a speed of 1 μl / cm with a film spraying machine to form a test line and a control line, respec...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
