Cellulase, encoding gene, recombinant vector and application thereof
A cellulase, recombinant vector technology, applied in application, genetic engineering, plant genetic improvement and other directions, can solve problems such as low utilization rate, environmental pollution, and aggravation of global greenhouse effect.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Example 1: Synthesis and cloning of the full-length cDNA of the GHF9 celY gene
[0048] The soil sample was the silt soil of Panjin, Liaoning, China (41.07 east longitude, 122.03 north latitude), and a soil genome library was constructed. According to the Congo red staining method (add 0.5% sodium carboxymethylcellulose to the screening medium, stain with 0.5% Congo red for 30 minutes, and decolorize with 1M NaCl for 30 minutes) to screen positive clones and construct a sub-library, and determine and analyze the obtained The nucleotide sequence of the open reading frame (ORF) of the GHF9 celY gene, design and amplify the primer upstream primer of the complete coding reading frame: CGGATCC ATGGAAATCGGTTTTTCAAAC; downstream primers: CAAGCTT CATTGTTGGAAGCAAAAG, and respectively introduce restriction endonuclease sites on the upstream and downstream primers (depending on the carrier selected, BamHI and HindIII enzyme cutting sites have been added in the present invention...
Embodiment 2
[0049] Example 2: Expression of GHF9 celY protein
[0050] The E. Coil BL21 / pET 28a / GHF9 celY obtained in Example 1 was cultured overnight on a shaker in LB liquid medium containing 100 mL of 50 μg / mL kanamycin. Pour 10ml of the overnight cultured bacterial solution into 1L of 50μg / mL kanamycin LB liquid medium for cultivation, until the OD600 of the bacterial solution reaches 0.6-0.8, add IPTG at a final concentration of 1.0mM, induce at 37°C for 5 hours, and collect by centrifugation Bacterial cells were resuspended with 25ml of phosphate buffer (pH7.4), added with lysozyme, the final concentration of lysozyme was 1 mg / ml, and the cells were broken by repeated freezing and thawing. The supernatant was collected by centrifugation, and the supernatant containing GHF9 celY was filtered through a 0.22 μm cellulose acetate filter membrane and then purified by nickel column affinity chromatography to obtain pure GHF9 celY enzyme. SDS-PAGE results showed that the apparent molecula...
Embodiment 3
[0051] Embodiment 3: The carboxymethylcellulose sodium hydrolysis activity (CMCase) of plate qualitative detection GHF9 celY
[0052] On an agarose plate containing 0.5% sodium carboxymethylcellulose, holes were punched using an Oxford cup, 50 μl of 4 mg / ml GHF9 celY was added dropwise, and incubated at 37° C. for 4 hours. 0.5% Congo red staining 30min, 1M NaCl solution decolorization 30min, visible carboxymethylcellulose sodium hydrolysis circle ( figure 2 ).
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 