Unlock instant, AI-driven research and patent intelligence for your innovation.

Cellulase, encoding gene, recombinant vector and application thereof

A cellulase, recombinant vector technology, applied in application, genetic engineering, plant genetic improvement and other directions, can solve problems such as low utilization rate, environmental pollution, and aggravation of global greenhouse effect.

Inactive Publication Date: 2010-05-12
HANGZHOU NORMAL UNIVERSITY
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These treatment methods have problems such as low utilization rate, environmental pollution, and potential safety hazards. In particular, straws are burned on the spot in the field, which not only wastes resources, but also increases carbon dioxide emissions and aggravates the global greenhouse effect.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cellulase, encoding gene, recombinant vector and application thereof
  • Cellulase, encoding gene, recombinant vector and application thereof
  • Cellulase, encoding gene, recombinant vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1: Synthesis and cloning of the full-length cDNA of the GHF9 celY gene

[0048] The soil sample was the silt soil of Panjin, Liaoning, China (41.07 east longitude, 122.03 north latitude), and a soil genome library was constructed. According to the Congo red staining method (add 0.5% sodium carboxymethylcellulose to the screening medium, stain with 0.5% Congo red for 30 minutes, and decolorize with 1M NaCl for 30 minutes) to screen positive clones and construct a sub-library, and determine and analyze the obtained The nucleotide sequence of the open reading frame (ORF) of the GHF9 celY gene, design and amplify the primer upstream primer of the complete coding reading frame: CGGATCC ATGGAAATCGGTTTTTCAAAC; downstream primers: CAAGCTT CATTGTTGGAAGCAAAAG, and respectively introduce restriction endonuclease sites on the upstream and downstream primers (depending on the carrier selected, BamHI and HindIII enzyme cutting sites have been added in the present invention...

Embodiment 2

[0049] Example 2: Expression of GHF9 celY protein

[0050] The E. Coil BL21 / pET 28a / GHF9 celY obtained in Example 1 was cultured overnight on a shaker in LB liquid medium containing 100 mL of 50 μg / mL kanamycin. Pour 10ml of the overnight cultured bacterial solution into 1L of 50μg / mL kanamycin LB liquid medium for cultivation, until the OD600 of the bacterial solution reaches 0.6-0.8, add IPTG at a final concentration of 1.0mM, induce at 37°C for 5 hours, and collect by centrifugation Bacterial cells were resuspended with 25ml of phosphate buffer (pH7.4), added with lysozyme, the final concentration of lysozyme was 1 mg / ml, and the cells were broken by repeated freezing and thawing. The supernatant was collected by centrifugation, and the supernatant containing GHF9 celY was filtered through a 0.22 μm cellulose acetate filter membrane and then purified by nickel column affinity chromatography to obtain pure GHF9 celY enzyme. SDS-PAGE results showed that the apparent molecula...

Embodiment 3

[0051] Embodiment 3: The carboxymethylcellulose sodium hydrolysis activity (CMCase) of plate qualitative detection GHF9 celY

[0052] On an agarose plate containing 0.5% sodium carboxymethylcellulose, holes were punched using an Oxford cup, 50 μl of 4 mg / ml GHF9 celY was added dropwise, and incubated at 37° C. for 4 hours. 0.5% Congo red staining 30min, 1M NaCl solution decolorization 30min, visible carboxymethylcellulose sodium hydrolysis circle ( figure 2 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a cellulase and an encoding gene, a recombinant vector and a genetic engineering host cell thereof, which belong to the technical field of bioengineering. The gene of the cellulase is derived from a soil macro genomic library, the protease consists of 678 amino-acid residues, the theoretical isoelectric point pI is 4.97, the theoretical molecular weight Mw is 73.17 kDa, and an SDS-PAGE result shows that the apparent molecular weight of the cellulase is about 70 kDa. By performing searching and comparison respectively in a protein data base and a nucleotide data base, any same amino acid sequences and nucleotide sequences are not discovered, so the cellulase is a novel cellulase named as GHF9 CelY. The optimal pH range of the cellulase is between 6.5 and 7.0, and the optimal enzyme reaction temperature of the cellulase is 37 DEG C. The cellulase has a good application prospect in the extraction of active components of a plant Chinese medicament (ginkgo leaf tablet). In a buffer system with the pH of 7.0 at the temperature of 37 DEG C, the GHF9 CelY with the final concentration of 0.8 mg / ml is used to process ginkgo leaf tablet powder for 1 hour, so the extraction rate of the total flavone of the ginkgo leaf tablet powder can be effectively improved and the increase rate reaches 19.43 percent.

Description

(1) Technical field [0001] The invention relates to a cellulase, a gene encoding the cellulase, a recombinant vector containing the encoding gene or a genetically engineered host cell, and an application of the cellulase and the encoding gene in extracting traditional Chinese medicines from plants. (2) Background technology [0002] Cellulase is a general term for a class of enzymes that can degrade cellulose. It is a multi-component composite biocatalyst, mainly composed of exo-β-1,4-glucosidase [EC.3.2.1.91], endo-β - 1,4-glucosidase [EC.3.2.1.4] and β-1,4-glucosidase [EC.3.2.1.21]. The earliest cellulase was discovered by Seilliere in 1906 from the digestive juice of snails, and then found in other animals, plants and microorganisms. Since the 1980s, due to the development of molecular biology and the rise of bioengineering technology, the research on cellulase has developed rapidly. [0003] Plants use carbon dioxide, and wood fibers produced through photosynthesis are...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/42C12N15/56C12N15/63C12N1/15C12N1/19C12N1/21C12N5/10C12P19/14
Inventor 黄黎锋谢恬王旭贾娟
Owner HANGZHOU NORMAL UNIVERSITY