Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Reactive reagent of nucleic acid amplification by chain replacement at room temperature and nucleic acid amplification method at room temperature thereof

A technology of nucleic acid amplification and strand replacement reaction at room temperature, which is applied in the fields of nucleic acid amplification technology, molecular diagnosis and molecular biology, and can solve problems that limit the wide application of isothermal nucleic acid amplification technology, and achieve high-efficiency isothermal nucleic acid amplification and technical requirements Low, to avoid the effect of cross-contamination

Active Publication Date: 2012-09-05
程奇 +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this technology still requires a temperature control device to maintain the reaction temperature (60-65 degrees), this dependence still limits the wide application of isothermal nucleic acid amplification technology to some extent

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reactive reagent of nucleic acid amplification by chain replacement at room temperature and nucleic acid amplification method at room temperature thereof
  • Reactive reagent of nucleic acid amplification by chain replacement at room temperature and nucleic acid amplification method at room temperature thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Singleplex Nucleic Acid Amplification

[0039] This embodiment takes the blood detection and screening of HIV virus in blood as an example, and specifically describes the implementation process of traditional PCR and the single-plex normal temperature nucleic acid amplification of the present invention. The present invention can be but not limited to the detection of HIV viral nucleic acid molecules. Other viral diseases can also be tested in a similar way. For different pathogenic microorganisms, only the primer sequence needs to be redesigned. The primers in this example were all designed by the applicant and commissioned to be synthesized by Shanghai Sangong Company.

[0040] Specifically, it is achieved through the following steps: select the full sequence of HIV-1, and submit it to the database (http: / / www.ncbi.nlm.nih.gov / ) on the website of the National Center for Biological Sciences (http: / / www.ncbi.nlm.nih.gov / ) for Blast retrieval (click Click the Blast but...

Embodiment 2

[0084] multiplex nucleic acid amplification

[0085] This embodiment takes the blood detection and screening of HIV, HBV and HCV three common viruses in the blood as an example, and specifically describes the realization process of multiple strand replacement nucleic acid amplification. The present invention can detect, but is not limited to, these three viral nucleic acid molecules. Other viral diseases can also be detected in a similar way. In the embodiment, the RNA virus HIV and HCV are included, and the DNA virus HBV is also included. For different pathogenic microorganisms, only the primer sequence needs to be redesigned. The primers in this example were all designed by the applicant and commissioned to be synthesized by Shanghai Sangong Company.

[0086] Specifically, it is achieved through the following steps: select the full sequence of HIV-1, HBV and HCV genotype 1-6, and submit it segmentally to the database on the website of the National Center for Biotechnology...

Embodiment 3

[0184] This example takes HCV virus as an example to specifically illustrate the examples of the efficient nucleic acid amplification process achieved by strand replacement reaction temperatures of 25, 30, and 40° C. in the room temperature nucleic acid amplification method of the present invention. The primers in this example were designed by the applicant and commissioned to be synthesized by Shanghai Sangong Company.

[0185] The primers for the strand displacement reaction were designed as follows:

[0186] Forward primer 5'AATGGAACTATCTGATTCTACCGTGTCCCAAGTCA 3'SEQ ID NO: 14

[0187] Reverse primer 5' CTTAGATTTCCACGCCTTCAGTAAGAAGTCAACCC 3' SEQ ID NO: 15

[0188] In the biosafety cabinet, use 4M guanidine isothiocyanate solution to extract high-purity DNA and RNA from the patient's blood sample to obtain 50 μl of total nucleic acid sample containing DNA and RNA, which is labeled as sample 1; take 2 μl from sample 1 to a New small PCR tubes, using SuperScript VILO TM c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a reactive reagent of nucleic acid amplification by chain replacement at room temperature, belonging to the field of molecular biology and comprising the following components: Tricine buffer solution, potassium chloride, magnesium chloride, dithiothreitol, polyethylene glycol (PEG), ATP, dNTPs, phosphocreatine, a primer pair, SSB protein, colon bacillus RecA protein, yeastRad 51 protein and Bsu DNA polymerase. The invention also discloses a nucleic acid amplification method at room temperature. The nucleic acid amplification of high sensitivity for non-instrument dependent single or multi-sequence single tube type amplification is realized at the room temperature under the chain replacement action of the yeast Rad 51 protein and the colon bacillus RecA protein. The method is used for realizing efficient nucleic acid amplification by the chain replacement under the condition of room temperature, has less use time and simple operation, and omits a traditional heat circulation by a PCR. The technique is also suitably applied to non-laboratory detecting places with a large number of samples.

Description

technical field [0001] The invention belongs to the field of molecular diagnosis and molecular biology, and specifically describes a highly sensitive nucleic acid amplification chain replacement reaction reagent that can realize non-instrument-dependent nucleic acid amplification under normal temperature conditions by utilizing the chain replacement effect of yeast Rad51 protein and Escherichia coli RecA protein And normal temperature nucleic acid amplification method. The invention can be used in basic molecular biology research, rapid diagnosis of disease pathogens, screening of hereditary diseases and tumor markers, etc., in any fields requiring nucleic acid amplification technology. Background technique [0002] Nucleic acid amplification technology is widely used in various fields such as disease detection. Through this technology, the efficient amplification of trace amounts of nucleic acid can be achieved, and a very small amount of specific nucleic acid sequence mol...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12P19/34C12Q1/68C12Q1/70C12R1/93
Inventor 黄震巨丁凌文程海荣方国伟严庆丰程奇
Owner 程奇
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com