Preparation method of methyl (R)-o-chloromandelate utilizing biocatalytic asymmetric reduction

A technology of methyl mandelate and biocatalysis, applied in the field of bioengineering, can solve the problems of unsolved coenzyme regeneration, increased cost, increased energy consumption, etc., and achieve good industrial application prospects, easy operation, and mild reaction conditions.

Inactive Publication Date: 2011-10-05
EAST CHINA UNIV OF SCI & TECH
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Ema et al. (Adv.Synth.Catal., 2008, 350:2039-2044) from Japan co-expressed carbonyl reductase Gre2 and glucose dehydrogenase, and used recombinant Escherichia coli as a catalyst to asymmetrically reduce 1M o-chlorobenzoylformic acid Synthesis of (R)-o-chloromandelic acid methyl ester with methyl ester, the conversion rate and enantioselectivity of the reaction can reach more than 99%, but this method does not solve the problem of coenzyme regeneration, and still needs to add an additional 1g / L expensive Coenzyme NADP + , which significantly increases the cost of production, and the reaction needs to be carried out at 20°C, which also increases energy consumption to a certain extent

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of methyl (R)-o-chloromandelate utilizing biocatalytic asymmetric reduction
  • Preparation method of methyl (R)-o-chloromandelate utilizing biocatalytic asymmetric reduction
  • Preparation method of methyl (R)-o-chloromandelate utilizing biocatalytic asymmetric reduction

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Cloning of aldehyde ketone reductase gene

[0040] According to the gene sequence (Gene ID 937984) of the reductase ytbE of Bacillus subtilis 168 included in Genbank, the PCR primers are designed as follows:

[0041] Upstream primer: CGCGGATCCATGACAACACATTTACAAGCAAAAG;

[0042] Downstream primer: CCGGTCGAGTTAAAAATCAAAGTTGTCCGGATC.

[0043] Among them, the underlined part of the upstream primer is the BamHI restriction site, and the underlined part of the downstream primer is the XhoI restriction site. The genomic DNA of Bacillus subtilis 168 (purchased from the Bacillus Genetics Bank of Ohio State University, BGSC) was used as a template for PCR amplification. The PCR system is: 2×Taq PCR MasterMix 15μl, upstream primer and downstream primer each 1μl (0.3μmol / L), DNA template 1μl (0.1μg) and ddH 2 O 12μl. The PCR amplification steps are: (1) 95℃, pre-denaturation for 5min; (2) 94℃, denaturation for 45s; (3) 60℃ annealing for 1min; (4) 72℃ extension for 1min; steps (...

Embodiment 2

[0044] Example 2 Preparation of recombinant plasmid pET28a-AKR

[0045] The target band of the aldone reductase gene recovered in Example 1 was digested with restriction enzymes BamHI and XhoI for 12 hours at 37°C, purified by agarose gel electrophoresis, and recovered by agarose gel DNA recovery kit Target fragment. Under the action of T4 DNA ligase, the target fragment was ligated with plasmid pET28a, which was also digested with BamHI and XhoI, at 4°C overnight to obtain recombinant plasmid pET28a-AKR.

Embodiment 3

[0046] Example 3 Cloning of glucose dehydrogenase gene

[0047] According to the glucose dehydrogenase gene sequence (Gene ID 938261) of Bacillus subtilis 168 included in Genbank, specific primers were designed:

[0048] Upstream primer: TGGTGGTGGTGGTGCTTAACCGCGGCCTGCCTGGAA;

[0049] Downstream primer: ACTTTGATTTTTAACAAGGAGATATACATATGTATCC.

[0050] The genomic DNA of Bacillus subtilis 168 was used as a template for PCR amplification. The PCR system is: 2×Taq PCR MasterMix 15μl, upstream primer and downstream primer each 1μl (0.3μmol / L), DNA template 1μl (0.1μg) and ddH 2 O 12μl. The PCR amplification steps are: (1) 95℃, pre-denaturation for 5min; (2) 94℃, denaturation for 45s; (3) 57℃ annealing for 1min; (4) 72℃ extension for 1min; steps (2)~(4) repeat 35 times; (5) Continue to extend at 72°C for 10 minutes and cool to 4°C. The PCR product was purified by agarose gel electrophoresis, and the target band in the range of 700 to 900 bp was recovered using the agarose gel DNA recovery...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
enantiomeric excessaaaaaaaaaa
enantiomeric excessaaaaaaaaaa
Login to View More

Abstract

The present invention discloses a preparation method of methyl (R)-o-chloromandelate utilizing biocatalytic asymmetric reduction and used recombinant vectors and genetically engineered bacteria. The preparation method comprises the step of carrying out biotransformation reaction on methyl o-chlorobenzoylformate used as the substrate with genetically engineered bacteria wet cells or freeze-dried cells capable of coexpressing recombinant reductase and recombinant glucose dehydrogenase as the catalyst at pH 6-8 in the presence of glucose, wherein the recombinant reductase is a recombinant aldo-keto reductase. The genetically engineered bacteria whole cells can simultaneously express the aldo-keto reductase and glucose dehydrogenase and can achieve high-efficiency regeneration of intracellular coenzyme NADP<+>. By using the preparation method, high-concentrations methyl o-chlorobenzoylformate can be catalyzed and completely transformed into methyl (R)-o-chloromandelate with a single conformation, without adding a coenzyme. Because of expensive coenzyme, the preparation method provided by the invention greatly lowers the production cost, has mild reaction conditions, is environmentally-friendly and simple to operate, and has good industrial application prospects.

Description

Technical field [0001] The invention belongs to the technical field of bioengineering, and particularly relates to a method for preparing (R)-methyl o-chloromandelic acid by asymmetric reduction of biocatalysis, as well as a used recombinant vector and genetic engineering bacteria. Background technique [0002] Clopidogrel (Clopidogrel), chemical name (S)-α-(2-chlorophenyl)-6,7-dihydrothieno[3,2-c]pyridine-5(4H)-methyl acetate, series A platelet aggregation inhibitor, which was successfully researched and developed by the French company Sanofi-Aventis in 1986. Its sulfate is clinically used, and its trade name is (Polivix), mainly used to treat atherosclerosis and other cardiovascular and cerebrovascular diseases. In 2009, the drug's global sales reached 10 billion U.S. dollars, second only to the lipid-lowering drug atorvastatin, and became the second best-selling drug in the global drug market. (R)-o-chloromandelic acid and its methyl ester are important chiral building block...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P7/62C12N15/63C12N15/53C12N1/21C12R1/19
CPCC12P7/62C12N9/0006C12P41/002
Inventor许建和倪燕潘江李春秀马宏敏
OwnerEAST CHINA UNIV OF SCI & TECH