Mutant nitrile hydratase

A nitrile hydratase and amino acid technology, applied in the directions of lyase, biochemical equipment and methods, applications, etc., can solve the problems of poor heat resistance of enzyme-producing cells, fluctuations in hydration temperature, and insufficient supply of cold energy for temperature control, and achieve good Prospects for industrial application, product tolerance improvement, effect of ultrasonic tolerance improvement

Active Publication Date: 2012-06-27
TSINGHUA UNIV
View PDF10 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In addition to product / substrate tolerance, in the catalytic hydration process of microbial production of acrylamide, another major problem that restricts production efficiency is the poor heat resistance of enzyme-producing cells, and the hydration temperature must be controlled by low-temperature refrigerants. 15-22℃
Since nitrile hydratase catalyzes the hydration of acrylonitrile to form acrylamide is a strong exothermic reaction, the supply of cooling capacity for temperature control in industrial production is often insufficient, resulting in fluctuations in the hydration temperature above 25 °C

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mutant nitrile hydratase
  • Mutant nitrile hydratase
  • Mutant nitrile hydratase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Embodiment 1 Improved nitrile hydratase NHM gene mutation and its transformant construction

[0023] (1) Referring to the method described in Tsinghua University patent (Chinese invention patent application number: 200910076710.1), using upstream primer: PNH-F: TTTAAGAAGGAGATATACCATGGATGGAT and downstream primer: PNH-R: CCGCAAGCTTTCATACGATCACTTC, routinely amplifies Rhodococcus ruber TH ( The nitrile hydratase gene (sequence shown in SEQ ID NO: 3) in the General Microbiology Center of China Committee for Microorganism Culture Collection (CGMCC No.2380) was subjected to NcoI / BamHI double enzyme digestion reaction at 37°C for 4h. Purify the resulting digested product with a PCR product recovery kit (Takara Company), and then use T4 DNA ligase (Promega Company) to perform a ligation reaction with the plasmid vector pET-28a (Novagen Company) at 4°C for 16 h; then transform the ligation reaction product Competent cells of host bacterium E.coli BL21 (DE3) (Tiangen Biochemical...

Embodiment 2

[0027] Embodiment 2 The present invention improves the expression of nitrile hydratase in transformants

[0028] The strain E.coli BL21(DE3) / pET-NHM obtained in Example 1 for inducible expression of the improved nitrile hydratase of the present invention due to SEQ ID NO: 5 was cultured in shake flasks. First inoculate a single colony in LB liquid medium containing 50mg / L kanamycin (composition: 50ml / 300ml shake flask, peptone 10g / L, yeast powder 5g / L, sodium chloride 10g / L, pH 7.0) , 37° C., 200 rpm for 12 hours, and make a seed bottle.

[0029]According to 1% inoculum amount, transfer from seed bottle to LB liquid medium (50ml) containing 50mg / L kanamycin and cultivate for 2.5h. Add 2% 0.5mol / L lactose, 0.2% 0.2mol / L CoCl 2 Acts as an inducer to induce nitrile hydratase expression. After culturing at 28°C for 8 hours, the cells were harvested for enzyme activity assay.

[0030] Enzyme activity was determined by gas chromatography with acrylonitrile as substrate. Take 3....

Embodiment 3

[0032] Embodiment 3 The stress resistance evaluation of the improved nitrile hydratase of the present invention

[0033] The 50ml recombinant bacterium E.coli BL21 (DE3) / pET-NHM cell (expressing improved nitrile hydratase) of embodiment 2 harvest and control bacterial strain E.coli BL21 (DE3) / pET-Nhase cell (expressing unmutated original nitrile hydratase) Enzyme) was centrifuged and washed once with an equal volume of sterile water, and then resuspended in an equal volume of 50mM PBS buffer at pH 7.0 for further use.

[0034] Take 5ml of the recombinant cells resuspended in PBS buffer and place them in a water bath at 42°C for 12h. The residual activity of the improved nitrile hydratase and the original nitrile hydratase were measured in parallel, and the results showed that the residual activity of the improved nitrile hydratase was 30%, while that of the unmutated nitrile hydratase was only 2%. The thermostability of the improved nitrile hydratase was significantly improve...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a heat and ultrasound tolerant mutant nitrile hydratase which belongs to the technical field of enzyme engineering and industrial microbes. The mutant nitrile hydratase is obtained by displacing at least one residue of amino acid residues in the nitrile hydratase with the amino acid sequence represented by SEQ ID NO:1 and adding 1-2 residues to a position behind the terminal residue of the amino acid sequence represented by the SEQ ID NO:1, and the displaced residue corresponds with 141Ser, 143Ser and 144Leu in the amino acid sequence represented by the SEQ ID NO:1. The stress resistance of the mutant nitrile hydratase is good, and the heat tolerance, the survivability and the ultrasonic survivability of the mutant nitrile hydratase are substantially improved.

Description

technical field [0001] The invention belongs to the technical fields of enzyme engineering and industrial microorganisms, and in particular relates to a heat-resistant and ultrasonic-resistant mutant nitrile hydratase, a construction method of the enzyme and its application in the production of acrylamide by a microbial method. Background technique [0002] Nitrile hydratase produced by microorganisms can efficiently catalyze the hydration of acrylonitrile to form acrylamide. Polyacrylamide produced by the polymerization of acrylamide has a very wide range of applications in industrial production fields such as tertiary oil recovery, water treatment, and papermaking. The use of nitrile hydratase produced by microorganisms to catalyze the production of acrylamide has a series of advantages, including the reaction at normal temperature and pressure, low energy consumption, simple and safe operation, high conversion rate of acrylonitrile, high product concentration and purity, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/88C12N15/60C12N15/63C12N1/21C12P13/02C12R1/19C12R1/365C12R1/15C12R1/01
Inventor于慧敏刘杰刘昌春陈杰沈忠耀
OwnerTSINGHUA UNIV