Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Bacillus amyloliquefaciens LSSE-62 and application thereof

A technology of amylolytic spores and bacilli, applied in the field of microorganisms, to achieve strong innovation, practicality, and important nutritional value

Active Publication Date: 2012-07-04
INST OF PROCESS ENG CHINESE ACAD OF SCI
View PDF4 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Peng Yong et al. isolated Bacillus amyloliquefaciens producing fibrinolytic enzymes from Douchi in my country, and conducted a preliminary study on liquid fermentation of fibrinolytic enzymes of Bacillus amyloliquefaciens (see reference 4 for details: Peng Yong, Zhang Yizheng. Bacillus amyloliquefaciens ( Bacillusamyloliquefaciens) DC-4 fermented fermented fermented fermented fermented fermented fermented fermented fermented fermented fermented fermented fermented fermented fermented fermented fermented fermented fermented rice optimization optimization. Food and fermentation industry, 2002, 28: 19-23), yet, also do not see the report that prepares fibrinolytic fermented fermented fermented fermented fermented fermented fermented enzymatic enzymatic enzymatically by Bacillus amyloliquefaciens specifically
There is no report on fermenting chickpea by Bacillus amyloliquefaciens

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus amyloliquefaciens LSSE-62 and application thereof
  • Bacillus amyloliquefaciens LSSE-62 and application thereof
  • Bacillus amyloliquefaciens LSSE-62 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] The screening of embodiment 1 bacterial strain

[0037] Weigh 1g of various bean paste products into a sterilized test tube, add 9mL of sterile water, seal, shake on a shaker for 5min, heat in a water bath at 80°C for 10min, let it cool down, draw the supernatant to dilute, apply and screen for culture base plate (fibrin 12g / L, peptone 10g / L, yeast powder 5g / L, sodium chloride 10g / L, agar powder 15g / L, pH 7.2), cultivated at 37°C for 48h, and selected the single plate with a larger transparent circle. Colonies were transferred to LB solid medium plates (peptone 10g / L, yeast powder 5g / L, sodium chloride 10g / L, agar powder 15g / L, pH 7.2), cultured and stored in a refrigerator at 4°C. Through strain activation, transfer to plasmin liquid fermentation medium (maltose 10g / L, soybean peptone 8.28g / L, yeast powder 0.74g / L, CaCl 2 2H 2 O 0.64g / L, K 2 HPO 4 ·3H 2 O 1g / L, MgSO 4 ·7H 2 (00.5g / L), 37°C, 180r / min, cultured for 48h. The detection of plasmin activity was carri...

Embodiment 2

[0038] Embodiment 2: the identification of bacterial strain

[0039] Morphology and Physiological and Biochemical Identification

[0040] Bacterial morphology and physiological and biochemical identification were carried out according to the "Bergey's Bacterial Identification Manual". When the strain LSSE-62 was grown on LB solid medium, the colonies were round, with neat edges, and the surface of the bacterial lawn was moist and mucus-like, translucent. Scanning electron microscope imaging revealed that the bacteria were in the shape of straight rods, 2-3×0.8-1.1 μm. Gram stain positive. The optimum growth temperature is 30-40℃, and the suitable pH is 6.5-7.5. Positive for starch hydrolysis, positive for casein hydrolysis, positive for nitrate utilization, positive for citrate utilization, and positive for gelatin liquefaction test.

[0041] 16S rRNA molecular identification

[0042] The total DNA of strain LSSE-62 was extracted by a bacterial genome extraction kit, and t...

Embodiment 3

[0043] Identification of embodiment 3 plasmin

[0044] The total DNA of strain LSSE-62 was extracted by bacterial genome extraction kit. By comparing the Bacillus plasmin gene, the primers for PCR amplification of the plasmin gene were designed as (aprF: CCGTGAGAGGCAAAAAGGTATGGATCA) and (aprR: ATTTACTGAGCTGCCGCCTGTACGTTG). The PCR program was: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 52°C for 45 s, extension at 72°C for 1 min, 30 cycles; extension at 72°C for 10 min. Gene sequencing was completed by ABI Prism 370 automatic sequencer. Through BLAST software comparison processing, the sequence similarity of this gene with the gene of Bacillus amyloliquefaciens plasmin DJ-4 (Genebank accession number: AY627764) reaches 99.7%, and the similarity of amino acid sequence with plasmin DJ-4 reaches 99.7%. 100%, indicating that the plasmin synthesized by the strain is the same as plasmin DJ-4.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the microbial field, in particular to bacillus amyloliquefaciens LSSE-62 and application thereof. According to the invention, a new bacillus amyloliquefaciens strain is screened, wherein the collection number is CCGMCC No. 4157; and through the strain, plasmin can be prepared by efficiently utilizing fermentation of chickpea, and antithrombin active ingredient can be secreted, so that the total phenol content, the total flavone content and the antioxidant activity of the chickpea are improved. A plasmin health-care food prepared by fermenting the chickpea with the strain has various health-care functions.

Description

technical field [0001] The invention relates to the field of microorganisms, in particular, the invention relates to Bacillus amyloliquefaciens LSSE-62 and application thereof. Background technique [0002] According to statistics, there are more than 15 million patients with thrombosis worldwide, and about 3 million patients die every year. Therefore, the development of thrombolytic drugs has always been a hot issue concerning human health. Compared with urokinase, plasminogen activator (t-PA) and streptokinase, the plasminase synthesized by Bacillus has become a popular choice for thrombolytic therapy in recent years because of its advantages of being oral, safe, efficient, durable and cheap. Product development hotspots (see reference 1: Peng Y, YangX, Zhang Y. Microbial fibrinolytic enzymes: an overview of source, production, properties, and thrombolytic activity in vivo. Appl Microbiol Biotechnol, 2005, 69: 126-132) . [0003] Fermented foods have a long history of b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20C12N9/68C12P21/02A23L1/20C12R1/07A23L11/00
Inventor 刘会洲魏雪团罗明芳谢渝春刘德明
Owner INST OF PROCESS ENG CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com