Bacillus amyloliquefaciens LSSE-62 and application thereof
A technology of amylolytic spores and bacilli, applied in the field of microorganisms, to achieve strong innovation, practicality, and important nutritional value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] The screening of embodiment 1 bacterial strain
[0037] Weigh 1g of various bean paste products into a sterilized test tube, add 9mL of sterile water, seal, shake on a shaker for 5min, heat in a water bath at 80°C for 10min, let it cool down, draw the supernatant to dilute, apply and screen for culture base plate (fibrin 12g / L, peptone 10g / L, yeast powder 5g / L, sodium chloride 10g / L, agar powder 15g / L, pH 7.2), cultivated at 37°C for 48h, and selected the single plate with a larger transparent circle. Colonies were transferred to LB solid medium plates (peptone 10g / L, yeast powder 5g / L, sodium chloride 10g / L, agar powder 15g / L, pH 7.2), cultured and stored in a refrigerator at 4°C. Through strain activation, transfer to plasmin liquid fermentation medium (maltose 10g / L, soybean peptone 8.28g / L, yeast powder 0.74g / L, CaCl 2 2H 2 O 0.64g / L, K 2 HPO 4 ·3H 2 O 1g / L, MgSO 4 ·7H 2 (00.5g / L), 37°C, 180r / min, cultured for 48h. The detection of plasmin activity was carri...
Embodiment 2
[0038] Embodiment 2: the identification of bacterial strain
[0039] Morphology and Physiological and Biochemical Identification
[0040] Bacterial morphology and physiological and biochemical identification were carried out according to the "Bergey's Bacterial Identification Manual". When the strain LSSE-62 was grown on LB solid medium, the colonies were round, with neat edges, and the surface of the bacterial lawn was moist and mucus-like, translucent. Scanning electron microscope imaging revealed that the bacteria were in the shape of straight rods, 2-3×0.8-1.1 μm. Gram stain positive. The optimum growth temperature is 30-40℃, and the suitable pH is 6.5-7.5. Positive for starch hydrolysis, positive for casein hydrolysis, positive for nitrate utilization, positive for citrate utilization, and positive for gelatin liquefaction test.
[0041] 16S rRNA molecular identification
[0042] The total DNA of strain LSSE-62 was extracted by a bacterial genome extraction kit, and t...
Embodiment 3
[0043] Identification of embodiment 3 plasmin
[0044] The total DNA of strain LSSE-62 was extracted by bacterial genome extraction kit. By comparing the Bacillus plasmin gene, the primers for PCR amplification of the plasmin gene were designed as (aprF: CCGTGAGAGGCAAAAAGGTATGGATCA) and (aprR: ATTTACTGAGCTGCCGCCTGTACGTTG). The PCR program was: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 52°C for 45 s, extension at 72°C for 1 min, 30 cycles; extension at 72°C for 10 min. Gene sequencing was completed by ABI Prism 370 automatic sequencer. Through BLAST software comparison processing, the sequence similarity of this gene with the gene of Bacillus amyloliquefaciens plasmin DJ-4 (Genebank accession number: AY627764) reaches 99.7%, and the similarity of amino acid sequence with plasmin DJ-4 reaches 99.7%. 100%, indicating that the plasmin synthesized by the strain is the same as plasmin DJ-4.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
