Bacillus subtilis for preventing and controlling plant fungal disease and application of bacillus subtilis

A technology for bacillus subtilis and plant fungal diseases, applied in the field of microorganisms and biological fertilizers, can solve the problems of single action object, poor effect, limited competitive survival ability, etc., and achieve the effect of broad antibacterial spectrum and good genetic stability

Inactive Publication Date: 2013-03-13
赵斌 +2
View PDF5 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005]However, most of the Bacillus subtilis known to have a control effect on plant fungal diseases are not effective, the target of action is relatively single, they are easily affected by the natural environment, and they compete for survival Limited and other disadvantages (Cheng Aili, Tang Wenhua, Wang Yimin. Acta Phytopathology, 1996)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus subtilis for preventing and controlling plant fungal disease and application of bacillus subtilis
  • Bacillus subtilis for preventing and controlling plant fungal disease and application of bacillus subtilis
  • Bacillus subtilis for preventing and controlling plant fungal disease and application of bacillus subtilis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 2 Screening of antagonistic strains

[0030] Screening of antagonistic bacteria for the prevention and treatment of plant fungal diseases: evenly add 100 μL to a sterilized Petri dish with a concentration of 1X10 7 cfu / mL Pythium cucumber suspension, pour 20 mL of molten LB medium cooled to about 50 °C and mix well. After the culture medium is completely solidified, use an inoculation loop to inoculate the antagonistic bacteria to be tested, spot 8-10 bacterial strains to be tested in each plate, and culture them in an incubator at 28°C for 48 hours to detect the presence and size of the inhibition zone. After the initial test, the strains with antagonistic effect were purified and repeated tests were carried out. The basic method was the same as above, and 3 strains were spotted on each plate, and each plate was repeated 3 times. The degree of antagonism was determined according to the width of the antagonism zone (distance between the edge of the inhibition...

Embodiment 2

[0031] Example 3 Sequence Determination and Analysis of 16S rDNA of Bacterial Strains and Identification of Physiological and Biochemical Tests

[0032] Bacillus subtilis DNA was extracted using the conventional phenol method, and the 16S rDNA sequence was amplified with bacterial universal primers. The primer sequences were 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT). The PCR reaction system (50 μL) was: 5 μL of 10X PCR buffer, 4 μL of dNTP, 1 μL of each primer, 2.5 μL of DNA template, 0.25 μL of Takara Taq enzyme, and 36 μL of ultrapure water. The PCR amplification program was 94 °C for 3 min; 94 °C for 1 min, 52 °C for 1 min, 72 °C for 1.5 min, 30 cycles; 72 °C for 10 min. The amplified products were sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing.

Embodiment 3

[0033] The measured 16S rDNA sequence was input into GenBank, and BLAST software was used for homology search. The 16S rDNA sequences of different strains were selected and compared with the known 16S rDNA sequences in GenBank.

[0034] Homology comparison results are as follows:

[0035] The results of the blast comparison of the PCR amplification product in GenBank showed that the bacterial strain MSB1201 of the present invention and its 50 highly homologous strains all belong to the genus Bacillus, and their homology is more than 98%. figure 2 The 16S rDNA sequence of MSB1201 is the same as Bacillus subtilis, Pseudomonas fluorescens, Pseudomonas aeruginosa, Acinetobacter baumannii, Acinetobacter sp, Alcaligenes faecalis, Bordetella hinzii, Bacillus pumilus, Bacillus cereus, Bacillus thuringiensis, Lysinibacillus sp, Microbacterium locophyresistens, Staples 16S rDNA cluster analysis of 15 species of bacteria. Bacillus subtilis described in the present invention and Bac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to efficient bacillus subtilis for preventing and controlling plant fungal disease and promoting plant growth. The bacillus subtilis is preserved in the China General Microbiological Culture Collection Center (CGMCC) with a preservation number of CGMCC No.6788. The bacillus subtilis related by the invention has a high capacity of inhibiting the growth of plant pathogenic fungi, has high hereditary stability, does not pollute the environment, is ecologically safe, and can be widely applied to prevention and control of plant pathogenic fungi, especially Pythium aphanidermatum, Fusarium, Sclerotinia sclerotiorum and Botrytis cinerea. The bacillus subtilis is singly used or is used together with other organic and inorganic nutrients required in the growth of plants to be prepared into a biological compound fertilizer which has the advantages of remarkable continuous cropping resistance, premature senility resistance, and control of dead seedlings and rotten roots and is capable of ensuring correct color and large fruits, and increasing output and improving quality of improved products.

Description

technical field [0001] The invention relates to the field of microbes and biological fertilizers, in particular to bacillus subtilis, in particular to a bacillus subtilis for preventing and treating fungal diseases of plants and an application thereof. Background technique [0002] Plant diseases are one of the main factors affecting agricultural production, and chemical pesticides have always played a very important role in the prevention and control of plant diseases and insect pests. However, due to the extensive use of chemical pesticides, it has brought many negative effects, such as polluting the ecological environment, endangering humans and animals, producing drug resistance, harming non-target organisms, and pesticide residues, which have seriously affected a series of problems such as human health and ecological balance. It prompts people to explore new plant pest control strategies that are harmless to humans and the environment and have good control effects. Wit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20A01N63/02A01P3/00C05G3/00C12R1/125
Inventor赵斌董金皋赵巍
Owner赵斌