Bacillus subtilis for preventing and controlling plant fungal disease and application of bacillus subtilis

A technology for bacillus subtilis and plant fungal diseases, applied in the field of microorganisms and biological fertilizers, can solve the problems of single action object, poor effect, limited competitive survival ability, etc., and achieve the effect of broad antibacterial spectrum and good genetic stability

Inactive Publication Date: 2013-03-13
赵斌 +2
View PDF5 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005]However, most of the Bacillus subtilis known to have a control effect on plant fungal diseases are not effective, the target of action is relatively single, they are

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus subtilis for preventing and controlling plant fungal disease and application of bacillus subtilis
  • Bacillus subtilis for preventing and controlling plant fungal disease and application of bacillus subtilis
  • Bacillus subtilis for preventing and controlling plant fungal disease and application of bacillus subtilis

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0029] Example 1 Isolation of microorganisms from soil samples

[0030] Collect the rhizosphere soil of healthy cucumber plants from the greenhouse of Hengshui City, Hebei, weigh 10g of soil and mix with 90mL sterile water, then take 1mL sample from it and dilute it with 9mL sterile water for 6 times. Into 10 -6 , 10 -7 , 10 -8 3 gradients (specific dilution methods such as figure 1 As shown), pipette 100 microliters of the last three gradients of bacterial suspension and spread on LB solid medium (medium composition: tryptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L , Agar, 15g / L) on the plate, with the last dilution as a control, incubate at 28°C and observe every 24h. Select the sterile colonies in the control, and the strains that grew colonies in the previous dilution, jump to single colonies according to the characteristics of the colony morphology, color and other characteristics, culture them in liquid LB medium, and purify the numbers.

Example Embodiment

[0031] Example 2 Screening of antagonistic strains

[0032] Screening of antagonistic bacteria for preventing and treating plant fungal diseases: Add 100 μL to a sterile petri dish at a concentration of 1X10 7 Pour the cfu / mL Pythium cucumber suspension into 20 mL of molten LB medium cooled to about 50°C and mix well. After the medium is completely solidified, inoculate the tested antagonistic bacteria with the inoculation loop spot, spot 8-10 bacterial strains to be tested in each dish, culture in a 28℃ incubator for 48 hours, and detect the presence and size of the inhibition zone. After the initial test, the antagonistic strains were purified and repeated tests were carried out. The basic method was the same as the above, and each plate was spotted with 3 strains, and each plate was repeated 3 times. The degree of antagonism is determined according to the width of the antagonistic zone (the distance between the edge of the inhibition zone and the edge of the colony). Antago...

Example Embodiment

[0033] Example 3 Sequence determination and analysis of 16S rDNA of strains and identification of physiological and biochemical tests

[0034] The DNA of Bacillus subtilis was extracted by conventional phenol method, and the 16S rDNA sequence was amplified with bacterial universal primers. The primer sequences were 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT). The PCR reaction system (50 μL) is: 10 X PCR buffer 5 μL, dNTP 4 μL, primers 1 μL each, DNA template 2.5 μL, Takara Taq enzyme 0.25 μL, and ultrapure water 36 μL. The PCR amplification program is 94 ℃ 3 min; 94 ℃ 1 min, 52 ℃ 1 min, 72 ℃ 1.5 min, 30 cycles; 72 ℃ 10 min. The amplified products are sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing.

[0035] The measured 16S rDNA sequence was input into GenBank, and BLAST software was used for homology search. The 16S rDNA sequences of different strains were selected and compared with the known 16S rDNA in GenBank.

[0036] The results of homology ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Login to view more

Abstract

The invention relates to efficient bacillus subtilis for preventing and controlling plant fungal disease and promoting plant growth. The bacillus subtilis is preserved in the China General Microbiological Culture Collection Center (CGMCC) with a preservation number of CGMCC No.6788. The bacillus subtilis related by the invention has a high capacity of inhibiting the growth of plant pathogenic fungi, has high hereditary stability, does not pollute the environment, is ecologically safe, and can be widely applied to prevention and control of plant pathogenic fungi, especially Pythium aphanidermatum, Fusarium, Sclerotinia sclerotiorum and Botrytis cinerea. The bacillus subtilis is singly used or is used together with other organic and inorganic nutrients required in the growth of plants to be prepared into a biological compound fertilizer which has the advantages of remarkable continuous cropping resistance, premature senility resistance, and control of dead seedlings and rotten roots and is capable of ensuring correct color and large fruits, and increasing output and improving quality of improved products.

Description

technical field [0001] The invention relates to the field of microbes and biological fertilizers, in particular to bacillus subtilis, in particular to a bacillus subtilis for preventing and treating fungal diseases of plants and an application thereof. Background technique [0002] Plant diseases are one of the main factors affecting agricultural production, and chemical pesticides have always played a very important role in the prevention and control of plant diseases and insect pests. However, due to the extensive use of chemical pesticides, it has brought many negative effects, such as polluting the ecological environment, endangering humans and animals, producing drug resistance, harming non-target organisms, and pesticide residues, which have seriously affected a series of problems such as human health and ecological balance. It prompts people to explore new plant pest control strategies that are harmless to humans and the environment and have good control effects. Wit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N1/20A01N63/02A01P3/00C05G3/00C12R1/125
Inventor 赵斌董金皋赵巍
Owner 赵斌
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap