LAMP visual rapid detection kit of silkworm densoviruses and detection method thereof
A technology for detecting kits and densoviruses, applied in biochemical equipment and methods, and microbial measurement/inspection. Sexual problems, easy to observe and judge, and simple to operate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] The preparation method of the silkworm densovirus LAMP visualization rapid detection kit comprises the following steps:
[0036] S1. Design of primers used in the detection of silkworm densovirus LAMP
[0037]According to the nucleotide sequence data (Genbank accession number: DQ017269.1) of the VD2 ssDNA genome of BmDNV-3 reported on the NCBI website (http: / / www.ncbi.nlm.nih.gov / ), use the online software: Primer ExplorerV4 Primer ExplorerV4 ( http: / / primerexplorer.jp / elamp4.0.0 / index.html ) to design primers, according to the principle of LAMP primer design, use DNAMAN software (6.0.3.99 Chinese version) to select the secondary structure of the primers, and finally select a set of primers for the detection of BmDNV. The primer sequences are as follows:
[0038] DF1: 5'-ATAAACTCGAGTACCGCC-3', the primer sequence is shown in SEQ ID NO:1.
[0039] DB1: 5'- GATCTACGTCAGTGATAAGAGA -3', the primer sequence is shown in SEQ ID NO:2.
[0040] DFI1: 5'- GTCACAAGGGCCGAAT...
Embodiment 2
[0057] The Bombyx mori densovirus LAMP visual rapid detection kit prepared in reference to Example 1 was used to detect the sensitivity of densovirus DNA in different concentration gradients
[0058] In this embodiment, the silkworm densovirus BmDNV (obtained by subtropical silkworm disease prevention and control expert laboratory of South China Agricultural University through conventional mulberry leaf addition) is used to subculture, and the silkworm densovirus provided by other laboratories in this field can also be used. BmDNV) was used as the material, and the DNA extracted by the boiling precipitation method was used as the template. EDTA was purchased from Beijing Dingguo Biotechnology Co., Ltd.; isopropanol was produced by Tianjin Damao Chemical Reagent Factory; absolute ethanol was produced by Tianjin Damao Chemical Reagent Factory.
[0059] S1. Extraction of Bombyx mori densovirus BmDNV template DNA by boiling precipitation method:
[0060] Take a silkworm sample ...
Embodiment 3
[0072] The Bombyx mori densovirus LAMP visual rapid detection kit prepared by referring to Example 1 is used to detect and detect the silkworm densovirus BmDNV with different reaction times
[0073] S1. extracting the template DNA of the silkworm densovirus BmDNV;
[0074] Biological material: Bombyx mori densovirus, subcultured by the Sericulture Biotechnology Laboratory of South China Agricultural University by adding mulberry leaves to silkworms (according to conventional experimental methods, a certain concentration of virus liquid is applied to the back of fresh mulberry leaves, and then fed Bombyx mori, to make silkworm infected); EDTA was purchased from Beijing Dingguo Biotechnology Co., Ltd.; isopropanol was produced by Tianjin Damao Chemical Reagent Factory; absolute ethanol was produced by Tianjin Damao Chemical Reagent Factory.
[0075] The extraction of the template DNA of Bombyx mori densovirus BmDNV described in step S1 adopts the boiling precipitation method, a...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com