Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

LAMP visual rapid detection kit of silkworm densoviruses and detection method thereof

A technology for detecting kits and densoviruses, applied in biochemical equipment and methods, and microbial measurement/inspection. Sexual problems, easy to observe and judge, and simple to operate

Inactive Publication Date: 2013-06-05
SOUTH CHINA AGRI UNIV
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the main detection methods of silkworm densovirus include specific disease observation method, immunoserological method, PCR method, etc., wherein immunoserological method adopts two-way immunodiffusion method (DID ), Convective Immunoelectrophoresis (CIEP), Enzyme-Linked Convective Immunoelectrophoresis (ELCIEP), Enzyme Histochemistry (IEHC), Soluble Enzyme-Antizyme (PAP), Dot Immunobinding Assay (DIBA), Biotin -Avidin system detection method (ABS) and latex agglutination test (LTA) and other methods are used for detection, but these methods have factors such as cumbersome virus isolation, high cost, low sensitivity, poor specificity, and slow diagnosis. There are certain limitations in the application
Although the PCR method is applied to the detection of densoviruses, and the detection sensitivity has been improved to some extent, it still cannot meet the needs of sericulture production and on-site detection due to the need for sophisticated instruments and equipment (Wang Yuxing, Cao Yisun, Qian Yuan Jun et al. Enzyme Convective Immunoelectrophoresis for Early Diagnosis of Bombyx mori Concentrated Nuclear Disease. Sericulture Science, 1983, 9(2):97-102); Qian Yuanjun, Hu Xuefang, Wang Honglin. Practical Research on Serodiagnosis of Bombyx mori Virus Diseases . Sericulture Science, 1984, 10(3):155-157; Kageyasu S, Hayakawa T, Isawa H et al. Detection of the Silkworm-pathogenic virus genomes by PCR. Journal of Sericultural Science of Japan, 1997, 66(6):477-483; Han Xu, Yao Qin, Gao Lu, etc. Replication of Bombyx mori densovirus (Zhenjiang strain, China) in different competent hosts. Chinese Journal of Bioengineering, 2007 , 23(1):145-151; Fu Yanhong, Tang Shunming, Qin Guangxing, etc. Cloning of the genome of Bombyx mori densovirus (Zhenjiang) strain and the rescue of silkworms transfected with recombinant plasmids from densovirus. Sericulture Science, 2008, 34(3):453-458; Yu Wei, Yao Qin, Guo Zhongjian, etc. Expression of non-structural protein 1 (NS1) of the silkworm densovirus Chinese strain. Acta Microbiology, 2008, 48(2):191-196)
At present, there is no relevant technical report on the application of LAMP method to detect the silkworm densovirus BmDNV

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP visual rapid detection kit of silkworm densoviruses and detection method thereof
  • LAMP visual rapid detection kit of silkworm densoviruses and detection method thereof
  • LAMP visual rapid detection kit of silkworm densoviruses and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] The preparation method of the silkworm densovirus LAMP visualization rapid detection kit comprises the following steps:

[0036] S1. Design of primers used in the detection of silkworm densovirus LAMP

[0037]According to the nucleotide sequence data (Genbank accession number: DQ017269.1) of the VD2 ssDNA genome of BmDNV-3 reported on the NCBI website (http: / / www.ncbi.nlm.nih.gov / ), use the online software: Primer ExplorerV4 Primer ExplorerV4 ( http: / / primerexplorer.jp / elamp4.0.0 / index.html ) to design primers, according to the principle of LAMP primer design, use DNAMAN software (6.0.3.99 Chinese version) to select the secondary structure of the primers, and finally select a set of primers for the detection of BmDNV. The primer sequences are as follows:

[0038] DF1: 5'-ATAAACTCGAGTACCGCC-3', the primer sequence is shown in SEQ ID NO:1.

[0039] DB1: 5'- GATCTACGTCAGTGATAAGAGA -3', the primer sequence is shown in SEQ ID NO:2.

[0040] DFI1: 5'- GTCACAAGGGCCGAAT...

Embodiment 2

[0057] The Bombyx mori densovirus LAMP visual rapid detection kit prepared in reference to Example 1 was used to detect the sensitivity of densovirus DNA in different concentration gradients

[0058] In this embodiment, the silkworm densovirus BmDNV (obtained by subtropical silkworm disease prevention and control expert laboratory of South China Agricultural University through conventional mulberry leaf addition) is used to subculture, and the silkworm densovirus provided by other laboratories in this field can also be used. BmDNV) was used as the material, and the DNA extracted by the boiling precipitation method was used as the template. EDTA was purchased from Beijing Dingguo Biotechnology Co., Ltd.; isopropanol was produced by Tianjin Damao Chemical Reagent Factory; absolute ethanol was produced by Tianjin Damao Chemical Reagent Factory.

[0059] S1. Extraction of Bombyx mori densovirus BmDNV template DNA by boiling precipitation method:

[0060] Take a silkworm sample ...

Embodiment 3

[0072] The Bombyx mori densovirus LAMP visual rapid detection kit prepared by referring to Example 1 is used to detect and detect the silkworm densovirus BmDNV with different reaction times

[0073] S1. extracting the template DNA of the silkworm densovirus BmDNV;

[0074] Biological material: Bombyx mori densovirus, subcultured by the Sericulture Biotechnology Laboratory of South China Agricultural University by adding mulberry leaves to silkworms (according to conventional experimental methods, a certain concentration of virus liquid is applied to the back of fresh mulberry leaves, and then fed Bombyx mori, to make silkworm infected); EDTA was purchased from Beijing Dingguo Biotechnology Co., Ltd.; isopropanol was produced by Tianjin Damao Chemical Reagent Factory; absolute ethanol was produced by Tianjin Damao Chemical Reagent Factory.

[0075] The extraction of the template DNA of Bombyx mori densovirus BmDNV described in step S1 adopts the boiling precipitation method, a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of molecular diagnosis and verification, and relates to a LAMP visual rapid detection kit of silkworm densoviruses and a detection method of the LAMP visual rapid detection kit of the silkworm densoviruses. The kit comprises four LAMP primers, deoxyribonucleic acid (DNA) extraction buffer solutions, LAMP reaction liquid, positive reference products, negative reference products and color development liquid to form a detection reaction system. A boiling precipitation method is adopted to fast extract the formwork DNA of samples to be detected, the formwork DNA is rapidly amplified under the constant temperature of 60 DEG C to 65 DEG C, developed dye is added to the formwork DNA, and identification results are observed through naked eyes under natural light. If the color of reaction products changes into green, the fact that the samples to be tested contain the silkworm densoviruses is confirmed, and if the color of reaction products changes into orange, the fact that the samples to be tested do not contain the silkworm densoviruses is confirmed. The kit has the advantages of being high in sensibility, strong in specificity, swift in reaction, easy to operate, and low in cost, and needs no special instruments or equipment, and reaction results are easy to observe and judge. The defects that the detection of the silkworm densoviruses is long in time, huge in workload, complex in operation and the like are overcome. The kit can meet the urgent needs of disease surveillance, on-site emergency situation and the detection of production samples.

Description

technical field [0001] The invention belongs to the technical field of molecular diagnosis and identification, and in particular relates to a rapid visual detection kit for silkworm densovirus LAMP and a detection method thereof. Background technique [0002] Bombyx mori is a model insect of Lepidoptera, which has important economic value. Silk and its fabrics are traditional foreign exchange earning materials in my country. Bombyx mori densovirus ( Bombyx mori densovirus , BmDNV) is the pathogen of viral diseases that commonly occur in silkworm cocoon production in my country, which seriously threatens the continuous and stable production of silk industry. [0003] Silkworm virus disease is a chronic infectious disease except for blood type pus disease, which has a rapid onset. Silkworms do not have any symptoms at the initial stage of infection, and generally take 4 to 5 days after infection to show symptoms, but this time is approaching the late stage. Diseased silkwor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68
Inventor 刘吉平杨吉龙
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products