Application of alcohol dehydrogenase in catalytic generation of ethyl (R)-4-chloro-3-hydroxy butyrate

A technology of ethyl hydroxybutyrate and alcohol dehydrogenase, which is applied in the biological field to achieve the effects of high yield, high yield and reduced production cost

Inactive Publication Date: 2013-06-19
NANJING UNIV OF TECH
View PDF0 Cites 24 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It has not been found that the alcohol dehydrogenase is used for COBE asymmetric reduction preparation ( R )-CHBE report

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of alcohol dehydrogenase in catalytic generation of ethyl (R)-4-chloro-3-hydroxy butyrate

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Embodiment 1: recombinant escherichia coli E. coli Rosetta (pET-22b-CA)

[0031] 1. Acquisition of Alcohol Dehydrogenase Gene

[0032] Candida albicans Candida albicans(purchased from Centraalbureauvoor Schimmelcultures (CBS) Fungal Biodiversiry Centre), medium YPD (g·L -1 ): Yeast extract 10g, peptone 20g, glucose 20g, add distilled water to 1L.

[0033] Candida albicans Candida albicans Inoculated in 5mL YPD liquid medium and cultured at 30°C until the logarithmic growth phase, and the genome was extracted using a genomic DNA extraction kit (Beijing Tianwei Bioengineering Co., Ltd. Yeast Genome Extraction Kit, GD2415 Yeast gDNA Kit).

[0034] The primers used to construct the expression vectors are provided with enzyme cutting sites, and the primer sequences are as follows:

[0035] The upstream primer (CA-sense containing NdeI) is: 5'- GGAATTC CATATGTCAATTCCATCTACTCAGTACG -3'

[0036] The downstream primer (CA-anti containing BamHI) is: 5'- CGC GGATCCTTATGG...

Embodiment 2

[0049] Embodiment 2: recombinant escherichia coli E. coli Fermentation of Rosseta (pET22b-CA)

[0050] pick recombinant bacteria E. coli Add Rosseta (pET-22b-CA) to LB medium containing antibiotics and culture overnight at 37°C with shaking. Then they were inoculated into fresh culture medium according to the inoculum amount of 2%, and cultivated to OD at 37°C. 600 At about 0.6, add IPTG to a final concentration of 0.8 mmol·L -1 , 25°C, 220rpm, after induction of expression for 10 h, centrifuge at 8000 rpm, 4°C for 10 min, discard the supernatant, and precipitate for later use.

[0051]

Embodiment 3

[0053] The precipitate of Example 2 was washed twice with sodium phosphate buffer (100 mmol L-1, pH 6.5), weighed 2 g (wet weight) of Escherichia coli sludge, and suspended in the reaction solution of 25 mL of the total system (pH 6.5 The volume ratio of potassium phosphate buffer to butyl acetate is 1:1). Add isopropanol 150mmol / L, COBE 25g / L, 30°C, 180rpm, 12h. product( R The yield of )-CHBE is 20.5 g / L, the yield of the product is: 82%, and the optical purity e.e% is 100%.

[0054] The detection method of product is as follows (the detection method of product is identical with embodiment 3 in the following examples):

[0055] For the aqueous phase reaction: after the reaction, centrifuge at 8000 rpm for 10 min to separate the organic layer and the aqueous layer. Carefully draw the upper layer of ethyl acetate through the organic membrane, add the internal standard, and save the test sample.

[0056] For water / organic two-phase reaction: after the reaction, centrifuge at...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of alcohol dehydrogenase with amino acid sequence disclosed as SEQ ID NO:2 in preparing ethyl (R)-4-chloro-3-hydroxy butyrate from ethyl 4-chloroacetoacetate by asymmetric reduction. By using alcohol dehydrogenase with amino acid sequence disclosed as SEQ ID NO:2 as a catalyst, ethyl 4-chloroacetoacetate as a substrate and NADH (nicotinamide adenine dinucleotide) as a cofactor, asymmetric reduction is carried out to prepare the ethyl (R)-4-chloro-3-hydroxy butyrate. The invention applies the alcohol dehydrogenase with amino acid sequence disclosed as SEQ ID NO:2 in preparing ethyl (R)-4-chloro-3-hydroxy butyrate from ethyl 4-chloroacetoacetate by asymmetric reduction for the first time, and has favorable effect. The enzyme activity is up to 5.6 U / mg, the yield of the substrate is up to 94%, and the enantiomeric excess value of the product is 100%. The yield is high, and the production cost is greatly lowered.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to the application of an alcohol dehydrogenase, in particular to the production of an alcohol dehydrogenase (alcohol dehydrogenase) in the asymmetric reduction reaction with ethyl 4-chloroacetoacetate as a substrate ( R )-4-Chloro-3-hydroxybutyrate ethyl ester. Background technique [0002] ( R )-4-chloro-3-hydroxybutanoate (Ethyl 4-chloro-3-hydroxybutanoate, ( R )-CHBE) is an important organic intermediate, which can be used in the synthesis of many active drugs, such as (-)-macrolactin A ((-)-macrolactin A), L-carnitine (L-carnitine) and the key chiral intermediate of R-Y-amino-β-hydroxybutyric acid (GABOB) [1,2] . [0003] With 4-chloroacetoacetate ethyl (4-chloroacetoacetate Ethyl COBE) as the hypochiral substrate of the reduction reaction, it is easy to synthesize and cheap, and it is used as the substrate for asymmetric reduction reaction to obtain ( R )-CHBE is a very cost-eff...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P7/62C12R1/19
Inventor严明许琳顾金海郝宁李艳魏淼
OwnerNANJING UNIV OF TECH