Recombinant ganoderma lucidum immunoregulatory protein, human serum albumin fusion protein, and preparation method and application thereof

An immunomodulatory protein, human serum albumin technology, applied in the direction of serum albumin, albumin peptides, fusion of prolonging plasma life, etc., can solve the problems of high clearance rate, difficult to meet pharmacokinetic parameters, etc. rate, high yield, and the effect of reducing degradation

Inactive Publication Date: 2014-01-22
张喜田 +1
View PDF6 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the molecular weight of Ganoderma lucidum immunomodulatory protein dimer is less than 26kDa, the clearance rate in the body may be high, and the pharmacokinetic parameters are difficult to meet the requirements of its new drug development. Therefore, the action time of LZ-8 in the body should be extended by technical means such as gene level fusion , laying a solid foundation for its application in clinical treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant ganoderma lucidum immunoregulatory protein, human serum albumin fusion protein, and preparation method and application thereof
  • Recombinant ganoderma lucidum immunoregulatory protein, human serum albumin fusion protein, and preparation method and application thereof
  • Recombinant ganoderma lucidum immunoregulatory protein, human serum albumin fusion protein, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Construction and expression of rLZ-8 fusion protein engineering strain

[0025] Construction parts: According to the codon preference of yeast, the sequences of the target fragments rLZ8-HSA, rLZ8-Fc1 and rLZ8-Fc4 were respectively synthesized and stored in the puc57 plasmid. Design primers containing restriction sites StuI and KpnI. Primers were synthesized as follows:

[0026] (1) LZ-8-HSA: 5' CATAGGCCTTCTGATACTGCTTTGA 3'

[0027] 5' CGGGGTACCGAATTCCTATTACA 3'

[0028] (2) LZ-8-Fc1: 5' GTTAGGCCTTCTGATACTGCTTTGA 3'

[0029] 5' TAGGGTACCTCATTTACCAGGGG 3'

[0030] (3) LZ-8-Fc4: 5' CCGAGGCCTTCTGATACTGCTT 3'

[0031] 5' GATGGTACCTCACGGAGCATGAG 3'

[0032] The target fragment was obtained by PCR. The PCR conditions were: start at 95°C for 30s, then 95°C for 30s, 58°C for 30s, 72°C for 2min, a total of 30 cycles, and finally 72°C for 10min and 16°C, standby.

[0033] 1% agarose electrophoresis identified target fragments at 2184bp (LZ-8-HSA), 1064bp (LZ-8-Fc...

Embodiment 2

[0037] Example 2 Fusion protein purification process

[0038] Since the fusion protein has a common LZ-8 structure, gravity column affinity chromatography, molecular sieve, immobilized metal chelate affinity chromatography (IMAC) method, hydrophobic chromatography ( HIC), anion exchange chromatography and other methods of purification, the specific methods are as follows:

[0039] Purification method of rLZ-8-Fc1 and rLZ-8-Fc4:

[0040] Microfiltration: Centrifuge the fermentation broth at 10,000 rpm to obtain the supernatant, then purify it with a hollow fiber column with a pore size of 100Kd (microfiltration), remove small molecule salts and sugars, and obtain 8L of pigment, nucleic acid, and protein Yellow clear liquid.

[0041] rProtein A Gravi Trap gravity column affinity chromatography: preparation buffer phase A: 0.22M phosphate buffer, pH 7.7, 0.15M sodium chloride, preparation buffer phase B: 0.1M citrate buffer, pH 4.0, Suction filtration at 0.22 μm, ultrasonic de...

Embodiment 3

[0050] Example 3 Comparison of different fusion proteins promoting proliferation of mouse splenocytes

[0051] The WST-1 method is used to detect the influence of the fusion protein on the proliferation of mouse splenocytes, which reflects the strength of its biological activity. The present invention adopts BALB / c female mice with a body weight of 20-22g, and the mice are killed by pulling the neck. Take the spleen under aseptic conditions and place it in a plate with 5ml of DMEM containing 10% calf serum in advance; mash the spleen with tweezers, filter the tissue suspension with gauze to remove the tissue pieces, and prepare the spleen cell suspension; Take 100 microliters of cell suspension and add 900 microliters of 2% glacial acetic acid solution to count under the microscope. Adjust the cell concentration to 5×10 with DMEM containing 2% calf serum 6 / ml; respectively prepare the fusion protein and rLZ-8 with the same molar concentration gradient, set 3 gradient concent...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
heightaaaaaaaaaa
Login to View More

Abstract

The invention relates to the field of biological pharmacy and in particular relates to preparation and application of ganoderma lucidum immunoregulatory protein and fusion protein by a gene engineering technological means. A series of experiments show that an in-vivo half-life period prolonging effect of the fusion protein is more remarkable than that of rLZ-8, an improvement effect of the biological activity of the fusion protein is more remarkable than that of the rLZ-8, and in particular, and a leukocyte number increasing effect and an anti-tumor effect of the fusion protein are more remarkable than those of the rLZ-8 in the aspects of treating leucopenia and resisting tumor.

Description

technical field [0001] The invention relates to the construction, expression, purification and application of a recombinant fusion protein, in particular to the preparation and application of a recombinant Ganoderma lucidum immunoregulatory protein and human serum albumin fusion protein for treating leukopenia and tumors caused by chemotherapy. Background technique [0002] Ganoderma lucidum immunomodulatory protein (LZ-8) is derived from the mycelium of Ganoderma lucidum, and its structural characteristics are as follows: including an N-terminal important domain required for dimer formation and a C-terminal FNIII domain, rLZ-8 The N-terminal domain of the LZ-8 monomer is composed of an α-helix and a β-strand, and the N-terminal α-helix and β-strand on the LZ-8 monomer form an important structure through spatial exchange with the same domain on another monomer. The dimer-binding domain of , which is dumbbell-shaped. It has been reported in the literature that LZ-8 has biolo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00A61K38/16A61K47/48A61P35/00A61P7/00
CPCA61K38/16C07K14/765C07K2319/31A61K38/385A61K36/074C07K14/375A61P1/16A61P35/00A61P7/00A61K2300/00A61K38/00
Inventor孙非梁重阳张喜田
Owner张喜田