Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for oxidizing binary primary alcohol by using alcohol dehydrogenase

A technology of alcohol dehydrogenase and primary alcohol, which is applied in the field of alcohol dehydrogenase oxidation of primary alcohol, can solve the problem of no reaction process reported in the literature, and achieve the effects of being beneficial to purification and subsequent operations, easy to enlarge, and environmentally friendly.

Active Publication Date: 2014-03-05
EAST CHINA UNIV OF SCI & TECH
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The primary alcohol oxidation products involved in the above-mentioned published reports are all aldehydes with a single functional group, but there are no literature reports on enzymes or microorganisms that selectively catalyze polyols to generate hydroxyaldehydes and their reaction processes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for oxidizing binary primary alcohol by using alcohol dehydrogenase
  • Method for oxidizing binary primary alcohol by using alcohol dehydrogenase
  • Method for oxidizing binary primary alcohol by using alcohol dehydrogenase

Examples

Experimental program
Comparison scheme
Effect test

experiment example 1

[0042] Experimental example 1 Screening and Analysis of Alcohol Dehydrogenase Gene

[0043] After screening and analyzing in the NCBI gene database by using bioinformatics means, the NAD-dependent alcohol dehydrogenase GOX0313 (Gene ID: 3249320) in the genome of Gluconobacter oxydans621H was determined as a candidate research object.

experiment example 2

[0044] Experimental example 2 Preparation of recombinant expression vectors and recombinant expression transformants

[0045] Primers were designed according to the gene sequence of alcohol dehydrogenase GOX0313, the upstream primer (SEQ ID No.2) is: ACG GAATTC ATGGCTGATACAATGCTCGC, the downstream primer (SEQ ID No.3) is: TTT GGATCC GATGGCTGATACAATGCTCG. Primers were synthesized by Shanghai Jierui Bioengineering Co., Ltd. The underlined part of the upstream primer is the BamHI restriction site, and the underlined part of the downstream primer is the HindIII restriction site. Then the genome of Gluconobacter oxydans 621H (from the German Culture Collection of Microorganisms) was used as a template. RCR amplified GOX0313 gene, agarose gel electrophoresis as shown figure 1 As shown, through DNA sequencing, the results show that the amplified alcohol dehydrogenase gene has the nucleotide sequence of SEQ ID No.1 in the sequence listing. The purified and recovered GOX0313 g...

experiment example 3

[0047] Experimental example 3 , Expression and purification of Escherichia coli recombinant alcohol dehydrogenase

[0048] The culture medium used in the culture of the recombinant expression transformant can be any conventional medium in the art that can make the transformant grow and produce the alcohol dehydrogenase of the present invention, for Escherichia coli, preferably LB medium: peptone 10g / L, yeast extract 5g / L, NaCl10g / L. The culture method and culture conditions are not particularly limited, and can be properly selected according to the common knowledge in the field according to the different factors such as host type and culture method, as long as the transformant can grow and produce the alcohol dehydrogenase of the present invention. Other specific operations for cultivating transformants can be performed according to routine operations in the art.

[0049] For escherichia coli bacterial strain, shake flask culture fermentative enzyme production preferably s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for oxidizing binary primary alcohol by using alcohol dehydrogenase. The method comprises the steps of 1, providing alcohol dehydrogenase which is (a) a protein with an amino acid sequence shown by SEQ ID No.1 or (b) polypeptide having at least more than 95% of homology with the amino acid sequence shown by the SEQ ID No.1 at an amino acid level; 2, in a Tris-HCl buffer solution with the pH value of 8.0-8.5, oxidizing a substrate namely binary primary alcohol into alcohol aldehyde by using alcohol dehydrogenase through an oxidation reaction in the presence of NADH (nicotinamide adenine dinucleotide hydrogen) oxidase NOX and NAD+ (nicotinamide adenine dinucleotide+). According to the method disclosed by the invention, alcohol dehydrogenase can be used as a catalyst to selectively oxidize binary primary alcohol compounds to prepare a variety of alcohol aldehyde. Compared with a chemical method for preparing alcohol aldehyde, the method disclosed by the invention is less in side reaction and has the advantages of mild reaction condition, environment friendliness, simplicity and convenience in operation, easiness in amplification and the like. A coenzyme circulating system used in the method disclosed by the invention does not generate byproducts, which is favorable for purification of a target product and subsequent operations.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for oxidizing dibasic primary alcohols with alcohol dehydrogenase. Background technique [0002] Some hydroxyaldehyde compounds with dual properties of alcohol and aldehyde are widely used in the field of organic synthesis, such as glycolaldehyde and 3-hydroxypropionaldehyde. Glycolic aldehyde, also known as glycolaldehyde, can be used as an amino acid, medicine, pesticide, photosensitive material or special polymer (polylactic acid-glycolic aldehyde polymer used as a drug delivery system, glycolaldehyde polymerized hemoglobin used as a blood substitute, etc.) It is a synthetic precursor and can be used as a food browning agent in mixture with other simple carbonyl compounds. 3-Hydroxypropanal is the synthetic precursor of acrylic acid and acrolein. [0003] The preparation methods of aldehydes mainly include plant extraction method (especially some aldehydes used for spic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12P7/24
Inventor 林金萍魏东芝张行星
Owner EAST CHINA UNIV OF SCI & TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More