Method for oxidizing binary primary alcohol by using alcohol dehydrogenase
A technology of alcohol dehydrogenase and primary alcohol, which is applied in the field of alcohol dehydrogenase oxidation of primary alcohol, can solve the problem of no reaction process reported in the literature, and achieve the effects of being beneficial to purification and subsequent operations, easy to enlarge, and environmentally friendly.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
experiment example 1
[0042] Experimental example 1 Screening and Analysis of Alcohol Dehydrogenase Gene
[0043] After screening and analyzing in the NCBI gene database by using bioinformatics means, the NAD-dependent alcohol dehydrogenase GOX0313 (Gene ID: 3249320) in the genome of Gluconobacter oxydans621H was determined as a candidate research object.
experiment example 2
[0044] Experimental example 2 Preparation of recombinant expression vectors and recombinant expression transformants
[0045] Primers were designed according to the gene sequence of alcohol dehydrogenase GOX0313, the upstream primer (SEQ ID No.2) is: ACG GAATTC ATGGCTGATACAATGCTCGC, the downstream primer (SEQ ID No.3) is: TTT GGATCC GATGGCTGATACAATGCTCG. Primers were synthesized by Shanghai Jierui Bioengineering Co., Ltd. The underlined part of the upstream primer is the BamHI restriction site, and the underlined part of the downstream primer is the HindIII restriction site. Then the genome of Gluconobacter oxydans 621H (from the German Culture Collection of Microorganisms) was used as a template. RCR amplified GOX0313 gene, agarose gel electrophoresis as shown figure 1 As shown, through DNA sequencing, the results show that the amplified alcohol dehydrogenase gene has the nucleotide sequence of SEQ ID No.1 in the sequence listing. The purified and recovered GOX0313 g...
experiment example 3
[0047] Experimental example 3 , Expression and purification of Escherichia coli recombinant alcohol dehydrogenase
[0048] The culture medium used in the culture of the recombinant expression transformant can be any conventional medium in the art that can make the transformant grow and produce the alcohol dehydrogenase of the present invention, for Escherichia coli, preferably LB medium: peptone 10g / L, yeast extract 5g / L, NaCl10g / L. The culture method and culture conditions are not particularly limited, and can be properly selected according to the common knowledge in the field according to the different factors such as host type and culture method, as long as the transformant can grow and produce the alcohol dehydrogenase of the present invention. Other specific operations for cultivating transformants can be performed according to routine operations in the art.
[0049] For escherichia coli bacterial strain, shake flask culture fermentative enzyme production preferably s...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
