Method for producing alpha-ketoisocaproate by whole-cell transformation

A technology of ketoisocaproic acid and cells, which is applied in the field of fermentation engineering, can solve the problems of bacterial toxicity, difficulty in large-scale use, and high price, and achieve the effects of less environmental pollution, short production cycle, and fast reaction rate

Active Publication Date: 2014-05-14
WUXI JINGHAI AMINO ACID
View PDF3 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Snake venom amino acid deaminase is the best studied deaminase, but it is expensive and difficult to use on a large scale
Free L-amino acid deaminase derived from bacteria and fungi, due to the production of hydrogen peroxide in the reaction process, has a toxic effect on bacteria, and heterologous expression will produce inclusion bodies, and the enzyme activity is low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing alpha-ketoisocaproate by whole-cell transformation
  • Method for producing alpha-ketoisocaproate by whole-cell transformation
  • Method for producing alpha-ketoisocaproate by whole-cell transformation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Embodiment 1L-Amino acid deaminase recombinant plasmid construction

[0022] Using the genome of Proteus vulgaris as a template, with

[0023] 5'CGC GGATCC ATGGCGATATCTAGAAGAAAATTTA3' is the forward primer, with

[0024] 5'CCG CTCGAG TTAGAATCTGTAAAGACTAAATGGTTT3' is the reverse primer, (the underlined parts are the restriction sites of BamH I and Xho I respectively) to amplify the target gene, and the nucleotide sequence of the target gene is shown in SEQ ID NO.1. After the PCR product was purified and digested, it was ligated with the vector pET28a(+) to construct the recombinant plasmid pET28a-lad (such as figure 1 ).

Embodiment 2

[0025] Embodiment 2 recombinant escherichia coli construction

[0026] The recombinant plasmid Pet28a-lad of Example 1 was transformed into the cloning host E.coli JM109, and a single colony grown on the LB ampicillin resistance plate was picked, PCR amplified, and positive transformants were selected to extract the plasmid, verified by double enzyme digestion, and the band Correct and sequenced, and transformed and expressed the host E.coli BL21(DE3) with the correct sequence.

Embodiment 3

[0027] Example 3 Condition optimization for whole cell conversion of L-leucine

[0028] Pick a single colony of recombinant Escherichia coli E.coli BL21(DE3) from the plate, inoculate it into the seed medium, cultivate it overnight, and inoculate it into 50mL fermentation medium with an inoculum of 2% (v / v), at 37°C , 200r / min culture to OD 600 0.4 to 1.5, add 0.4mM IPTG to induce, cultivate at 37°C for 5 hours, and collect the bacteria by centrifugation for whole cell transformation. With water as the reaction medium, conversion conditions:

[0029] When the cell concentration is 1.0g / L, under the conditions of different concentrations of L-leucine (25mM, 50mM, 75mM, 100mM, 125mM, 150mM), transform at 37°C for 12h to investigate the effect of the substrate concentration on the yield. When the concentration of L-leucine was 100mM, the maximum yield reached 11.84g / L, and the conversion rate reached 90.95%.

[0030] When the concentration of L-leucine was 100mM, different con...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing alpha-ketoisocaproate by whole-cell transformation, belonging to the field of fermentation engineering. The method comprises the steps of firstly, constructing a genetically engineered bacterium of a heterologous expression amino acid deaminase gene, taking leucine as a substrate and producing the alpha-ketoisocaproate by whole-cell catalysis through a recombinant strain. The method has the advantages of being low in production cost, mild in production conditions, less in impurities in a transformation system, simple in processing steps, safe in production operation, etc. The alpha-ketoisocaproate produced by the method is high in yield, the transformed liquid per liter contains 12.69g of alpha-ketoisocaproate, and the conversion rate of L-leucine reaches 97.49%.

Description

technical field [0001] The invention relates to a method for producing α-ketoisocaproic acid through transformation of whole cells, belonging to the technical field of fermentation engineering. Background technique [0002] α-Ketoisocaproic acid (KIC), also known as α-oxoisovaleric acid, is an intermediate metabolite of branched-chain amino acid leucine, and is a branched-chain α-keto acid that plays an important role in organisms. The intermediates of organic synthesis, drug synthesis and biosynthesis have important application prospects in medicine, food, feed and other industries. At present, the production methods of KIC are mainly chemical synthesis methods, mainly including the hydrolysis reaction of the addition product of diethyl oxamide and Grignard reagent, double carbonylation method, Heine method and so on. The reaction conditions of these methods are harsh, and all require a special structure as a starting material, or an expensive catalyst (such as a complex o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/70C12P7/40C12R1/19C12R1/37
Inventor陈坚刘龙堵国成李江华宋阳
OwnerWUXI JINGHAI AMINO ACID