Alkaline pectate lyase (PelA) as well as encoding gene and application thereof

A technology of pectate lyase and coding gene, which is applied in the field of alkaline pectate lyase PelA and its coding gene and application, can solve the problems of increasing the complexity and cost of process conditions, and achieve good temperature and pH stability , high activity, safe and reliable effect

Inactive Publication Date: 2014-05-21
NANJING FORESTRY UNIV
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The traditional alkaline pectate lyase needs to have catalytic activity in the presence of calcium ions, and calcium ions are added when it needs to be used, which increases the complexity and cost of the process conditions. Therefore, if the alkaline pectate lyase does not require calcium ions, and under caustic conditions, it still has high activity and stability and will be an excellent enzyme source for industrial applications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Alkaline pectate lyase (PelA) as well as encoding gene and application thereof
  • Alkaline pectate lyase (PelA) as well as encoding gene and application thereof
  • Alkaline pectate lyase (PelA) as well as encoding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Cloning of Example 1 Gene

[0033]Extraction of RNA and preparation of template: The mycelium of the straw mushroom was inoculated on the rice straw medium for 8 days, and the mycelium was extracted with TRIZOL regent of invitrogen: the collected mycelium was ground into powder with liquid nitrogen, and an appropriate amount of powder was added to 1mL TRIZOL regent , after mixing evenly, let stand at room temperature for 5 minutes. Add chloroform, shake and mix well, and let stand at room temperature for 2-3 min. Centrifuge at 12000g for 15min. Transfer the supernatant to a clean centrifuge tube, add isopropanol, mix well and let stand at room temperature for 10 minutes, centrifuge at 12000g to discard the supernatant, wash the precipitate with 75% ethanol, and centrifuge at 7500g. Dry the RNA, pay attention to the fact that the RNA cannot be completely dried, dissolve the RNA with TE buffer, and incubate at 55-60°C for 10 minutes. The templates of 5' RACE and 3' RAC...

Embodiment 2

[0035] Example 2 Expression and purification of alkaline pectate lyase PelA in Pichia pastoris

[0036] Alkaline pectate lyase PelA was expressed using EasySelect Pichia Expression Kit (invitrogen). Two primers 5'-TGCCG were designed respectively GAATTC CGATTCCGATCGAACCCTCTGAGCA -3’ and 5’- GC TCTAGA TTAATGATGATGATGATGATGATGAAATGTCAAGGTCTGGCCG -3', using the PCR method to introduce two restriction enzyme sites EcoRI and XbaI at the N-terminal and C-terminal of xylanase respectively, after double-digestion, use the same double-digestion expression vector pPICZαB T4 DNA ligase ligation, the ligated recombinant plasmid pPICZαB--PelA was linearized by restriction endonuclease SacI and then electroporated into Pichia pastoris After KM71H, positive clones were screened using YPD plates containing 1 M sorbitol and 100 μg / mL Zeocin (Invitrogen) antibiotics. Insert the screened positive clones into a test tube containing 3mL YPD and 3μL antibiotic Zeocin at 28°C-30°C and culture...

Embodiment 3

[0038] Example 3 Activity Analysis of Alkaline Pectate Lyase PelA

[0039] Determination of pectate lyase activity: put the reaction system without enzyme (990μL reaction solution, containing 0.2% polygalacturonic acid (PGA), 100mM Glycine-NaOH buffer solution at pH 10.0) at 60 Preheat in a constant temperature water bath at ℃ for 5 minutes, add 0.1 mL of purified alkaline pectate lyase PelA (about 1 μg, prepared in Example 2) that has been properly diluted to the reaction solution, and react for 10 minutes, then add 500 mM hydrochloric acid Stop the reaction with 0.5mL of stop solution, centrifuge, take the supernatant, and measure the absorbance value A at 235 nm 235 . One enzyme activity unit: the amount of enzyme required to produce 1 μmol of unsaturated product per minute.

[0040] 1) Determination of the optimum pH and pH stability of alkaline pectate lyase PelA

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an alkaline pectate lyase (PelA) as well as an encoding gene and application thereof. The amino acid sequence of the alkaline PelA is shown by SEQID No. 1. The alkaline PelA is a new PelA obtained by cloning in edible straw mushrooms, has the optimum temperature of 60 DEG C and the optimum pH of 10.0, has good temperature and pH stability, and is high in catalytic performance under the condition that exogenous calcium ions do not exist, thus having good application prospect in the industrial application. Furthermore, the alkaline PelA is derived from the edible mushrooms, thus being safe and reliable; therefore, the alkaline PelA is widely applied to the industries such as food, feed and medicine.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to an alkaline pectate lyase PelA, its coding gene and its application. Background technique [0002] Pectin molecules are polysaccharide chains polymerized by galacturonic acid with different degrees of esterification through α-1,4 glycosidic bonds. The structure of pectin varies with plant species, tissue parts, growth conditions, etc., and is mainly divided into three types, which are Homogalacturonan (HGA), rhamnogalacturonan I (Rhamnogalacturonan I, RG-I) and rhamnogalacturonan II (Rhamnogalacturonan II, RG-II). Pectin widely exists in higher plants and is an important component of the intercellular layer and primary wall between plant cells. Pectin plays a role of "glue" in the cell tissue of plants, and once the pectin in plant tissue decomposes, it will cause the cells to segregate. Pectin is mainly a linear polymer formed by connecting D-galacturo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/88C12N15/60C12N15/81C12R1/84
CPCC12N9/88C12Y402/02002
Inventor丁少军史爱芹郑斐
OwnerNANJING FORESTRY UNIV