Kiwi fruit gene capable of improving tomato fruit nutrition quality and use thereof

A technology of kiwi fruit and tomato, applied in application, genetic engineering, plant gene improvement, etc., can solve problems such as incomplete sequences and unverified biological functions

Active Publication Date: 2014-08-27
HEFEI UNIV OF TECH
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although the genome database (http: / / bioinfo.bti.comell.edu / cgi-bin / kiwi / home.cgi) has disclosed the EST sequence of kiwifruit with the accession number Achn385381, through bioinformatics analysis, the EST sequence may be related to fruit nutritional quality. Relevant, but the sequence is not complete and has not been validated for biological function
In addition, although many studies have used exogenous genes to genetically transform tomato to improve tomato fruit quality and pigment content, but no gene that affects the nutritional quality of kiwifruit has been found before and the application of this gene in improving fruit quality has not been seen before.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kiwi fruit gene capable of improving tomato fruit nutrition quality and use thereof
  • Kiwi fruit gene capable of improving tomato fruit nutrition quality and use thereof
  • Kiwi fruit gene capable of improving tomato fruit nutrition quality and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Embodiment 1: the cloning of kiwifruit gene sequence SEQ ID NO.1 of the present invention

[0026] 1.1 Extraction of kiwi fruit RNA

[0027] 1.1.1 Grind the kiwi fruit pulp tissue quickly with liquid nitrogen, add Trizol at 50-100 mg tissue / ml Trizol, shake vigorously, and place at room temperature for 5 minutes.

[0028] 1.1. Centrifuge at 212,000rpm for 5min.

[0029] 1.1.3 Take the supernatant, add chloroform at the rate of 200 μl chloroform / ml Trizol, shake vigorously for 15 seconds, and place at room temperature for 3 minutes.

[0030] 1.1.4 Centrifuge at 12,000g for 15min at 4°C.

[0031] 1.1.5 Take the supernatant, add isopropanol to 0.5ml isopropanol / ml Trizol, mix well, and place at room temperature for 10min.

[0032] 1.1.6 Centrifuge at 12,000g at 4°C for 10 minutes, discard the supernatant, and sink the RNA to the bottom of the tube.

[0033] 1.1.7 Add 75% ethanol to 1ml75% ethanol / ml Trizol, shake the centrifuge tube gently, and suspend the precipitate. ...

Embodiment 2

[0057] Embodiment 2: Construction and functional identification of the vector containing kiwifruit gene sequence SEQ ID NO.1 of the present invention

[0058] According to the sequence table SEQ NO.1 sequence design forward primer 5'GC TCTAGA ATGGAGAGTTTTTCTCATGGGGGGAG 3′ and reverse primer 5′C GAGCTC TTAGGATATGTCGTCGAATTTAGGGTT3', wherein the underlined nucleic acids are respectively XbaI and SacI restriction sites, and the amplified gene fragments are as follows figure 1 , wherein from left to right, electrophoresis lane 1 is the molecular weight marker, and lane 2 is the amplified gene fragment of SEQ ID NO.1 with a size of about 1200bp.

[0059] 2.1 For identifying the cloned gene function, design and construct the plant expression vector of the gene ( figure 2 ). The amplified PCR fragment and the eukaryotic expression vector were digested with XbaI and SacI (both endonucleases are products of Treasure Bioengineering (Dalian) Co., Ltd.) respectively, and the enzyme ...

Embodiment 3

[0093] Embodiment 3: RT-PCR verifies the expression of kiwifruit gene sequence SEQ ID NO.1

[0094] The test materials used include Taq DNA polymerase, Trizol reagent, and reverse transcription kit purchased from Transgene; PCR primers were synthesized by Nanjing GenScript; the rest of the reagents were imported or domestically produced analytically pure products. Tomato wild-type seeds are AC+, kept in the laboratory.

[0095] 3.1 RNA extraction from tomato

[0096] 3.1.1 Grind tomato tissue rapidly with liquid nitrogen respectively, add Trizol at 50-100 mg tissue / ml Trizol, shake vigorously, and place at room temperature for 5 minutes.

[0097] 3.1. Centrifuge at 212,000 rpm for 5 minutes.

[0098] 3.1.3 Take the supernatant, add chloroform at 200 μl chloroform / ml Trizol, shake vigorously for 15 seconds, and place at room temperature for 3 minutes.

[0099] 3.1.4 Centrifuge at 12,000g for 15min at 4°C.

[0100] 3.1.5 Take the supernatant, add isopropanol to 0.5ml isoprop...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kiwi fruit gene capable of improving tomato fruit nutrition quality and a use thereof. The kiwi fruit gene has a DNA sequence shown in the formula of SEQ ID NO.1 in the sequence table. The kiwi fruit gene is cloned in a eukaryotic expression vector so that a plasmid containing the kiwi fruit gene sequence shown in the formula of SEQ ID NO.1 is obtained. Agrobacterium is transformed by the plasmid and the transformed agrobacterium is used for infecting tomato callus so that a transgenic plant capable of improving tomato fruit sugar content and pigment content is obtained. Compared with the wild tomato fruit, the transgenic tomato fruit has obviously improved sugar content, lycopene content, beta-carotene content and chlorophyll content. The kiwi fruit gene having the DNA sequence shown in the formula of SEQ ID NO.1 has an important theory meaning and a practical application value for research, regulation and control of a fruit pigment accumulation process and improvement of fruit nutrition quality.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, and specifically relates to a gene sequence related to the nutritional quality of kiwifruit fruit, a eukaryotic expression recombinant plasmid containing the gene and an application method of the constructed eukaryotic expression vector in improving the nutritional quality of tomato fruit. Background technique [0002] The pigment content in the fruit is an important factor affecting the external appearance, and the sugar, carotenoid, vitamin, mineral content, etc. determine the nutritional value of the fruit. At present, three methods are often used to increase the pigment content in the fruit and improve the nutritional quality of the fruit. The first way is to transform the structural genes in the pigment synthesis pathway. For example, the American Journal of Metabolic Engineering (Metabolic Engineering. 2013, 17: 59-67) introduced the transformation of tomato into Haematoco...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C12N15/82C12N15/84A01H5/00
Inventor李光伟牛向丽周昂陈丹阳刘永胜
OwnerHEFEI UNIV OF TECH