Kiwi fruit gene capable of improving tomato fruit nutrition quality and use thereof
A technology of kiwi fruit and tomato, applied in application, genetic engineering, plant gene improvement, etc., can solve problems such as incomplete sequences and unverified biological functions
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Embodiment 1: the cloning of kiwifruit gene sequence SEQ ID NO.1 of the present invention
[0026] 1.1 Extraction of kiwi fruit RNA
[0027] 1.1.1 Grind the kiwi fruit pulp tissue quickly with liquid nitrogen, add Trizol at 50-100 mg tissue / ml Trizol, shake vigorously, and place at room temperature for 5 minutes.
[0028] 1.1. Centrifuge at 212,000rpm for 5min.
[0029] 1.1.3 Take the supernatant, add chloroform at the rate of 200 μl chloroform / ml Trizol, shake vigorously for 15 seconds, and place at room temperature for 3 minutes.
[0030] 1.1.4 Centrifuge at 12,000g for 15min at 4°C.
[0031] 1.1.5 Take the supernatant, add isopropanol to 0.5ml isopropanol / ml Trizol, mix well, and place at room temperature for 10min.
[0032] 1.1.6 Centrifuge at 12,000g at 4°C for 10 minutes, discard the supernatant, and sink the RNA to the bottom of the tube.
[0033] 1.1.7 Add 75% ethanol to 1ml75% ethanol / ml Trizol, shake the centrifuge tube gently, and suspend the precipitate. ...
Embodiment 2
[0057] Embodiment 2: Construction and functional identification of the vector containing kiwifruit gene sequence SEQ ID NO.1 of the present invention
[0058] According to the sequence table SEQ NO.1 sequence design forward primer 5'GC TCTAGA ATGGAGAGTTTTTCTCATGGGGGGAG 3′ and reverse primer 5′C GAGCTC TTAGGATATGTCGTCGAATTTAGGGTT3', wherein the underlined nucleic acids are respectively XbaI and SacI restriction sites, and the amplified gene fragments are as follows figure 1 , wherein from left to right, electrophoresis lane 1 is the molecular weight marker, and lane 2 is the amplified gene fragment of SEQ ID NO.1 with a size of about 1200bp.
[0059] 2.1 For identifying the cloned gene function, design and construct the plant expression vector of the gene ( figure 2 ). The amplified PCR fragment and the eukaryotic expression vector were digested with XbaI and SacI (both endonucleases are products of Treasure Bioengineering (Dalian) Co., Ltd.) respectively, and the enzyme ...
Embodiment 3
[0093] Embodiment 3: RT-PCR verifies the expression of kiwifruit gene sequence SEQ ID NO.1
[0094] The test materials used include Taq DNA polymerase, Trizol reagent, and reverse transcription kit purchased from Transgene; PCR primers were synthesized by Nanjing GenScript; the rest of the reagents were imported or domestically produced analytically pure products. Tomato wild-type seeds are AC+, kept in the laboratory.
[0095] 3.1 RNA extraction from tomato
[0096] 3.1.1 Grind tomato tissue rapidly with liquid nitrogen respectively, add Trizol at 50-100 mg tissue / ml Trizol, shake vigorously, and place at room temperature for 5 minutes.
[0097] 3.1. Centrifuge at 212,000 rpm for 5 minutes.
[0098] 3.1.3 Take the supernatant, add chloroform at 200 μl chloroform / ml Trizol, shake vigorously for 15 seconds, and place at room temperature for 3 minutes.
[0099] 3.1.4 Centrifuge at 12,000g for 15min at 4°C.
[0100] 3.1.5 Take the supernatant, add isopropanol to 0.5ml isoprop...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
