Engineering bacteria based on glutamine synthetase and implementation method of engineering bacteria
A technology of glutamine and synthetase, which is applied in the field of genes and engineering strains in the field of biogenetic engineering technology, can solve the problems of low expression level and low fertilizer utilization rate, and achieve the effect of maintaining protein activity and ensuring protein purity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] This embodiment includes the following steps:
[0029] 1) Isolation and cultivation of Streptomyces grisea
[0030] Streptomyces grisea was isolated from rotten straw collected in Pujiang Town, Shanghai, and the preservation number was CGMCC No.5706. The strain was inoculated in LB liquid medium and cultured at 32°C for 48h.
[0031] The above LB liquid medium components are: peptone 10.0g / L, yeast extract 5.0g / L, NaCl 10.0g / L, pH 6.8-7.2. Add 15.0‐20.0g / L agar to the liquid medium to obtain LB solid medium.
[0032] 2) Genomic DNA extraction
[0033] Collect 2.0 mL of bacterial liquid and centrifuge at 12000 rpm for 2 min. Discard the supernatant, collect the bacterial pellet, add 180μL lysozyme (20mg / mL) and 20μL EDTA solution (0.5M, pH8.0), treat at 37℃ for 45min, add 4μL RNase A (100mg / mL), shake and mix for 15s , placed at room temperature for 5 minutes, and then completed the remaining operations according to the instructions of the bacterial DNA extraction k...
Embodiment 2
[0057] Construction of glutamine synthetase expression vector
[0058] 1) According to the glutamine synthetase sequence, design primers containing restriction sites, the sequence is as follows:
[0059] GE‐Msc I‐F:GATGGCCATGGGGAAGCGGAAGATGGACAAGCAGC
[0060] GE‐EcoR I‐R:GGAATTCTCA ATGATGATGATGATGATG CAGCACCGGCAGCAGGTTC
[0061] 2) Using Streptomyces griseorubens genomic DNA as a template, PCR amplification was performed with primers containing Msc I and EcoR I restriction sites to obtain the glutamine synthetase gene sequence, using DNA A-Tailing Kit plus A After connecting to T‐Vector PMD TM 19‐T (TaKaRa), and the ligation product was transferred into DH5α E. coli. Select positive clones on the ampicillin (50 μg / mL) resistance plate, and shake the bacteria to extract the plasmid and sequence it. If there is no mistake, Msc I and EcoR I were subjected to double enzyme digestion (37° C.), and the DNA fragment GE of the large subunit of glutamine synthetase was recovered. ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com