Engineering bacteria based on glutamine synthetase and implementation method of engineering bacteria

A technology of glutamine and synthetase, which is applied in the field of genes and engineering strains in the field of biogenetic engineering technology, can solve the problems of low expression level and low fertilizer utilization rate, and achieve the effect of maintaining protein activity and ensuring protein purity

Inactive Publication Date: 2014-11-12
SHANGHAI JIAO TONG UNIV
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Aiming at the deficiencies in the prior art, the present invention proposes an engineering bacterium based on glutamine synthetase and its realization method. Through the method described in the present invention, a glutamine synthesis cloned from Streptomyces grisea can be efficiently expressed. The enzyme can overcome the shortcomings of the low expression level of glutamine synthetase in the original strain, and help solve the problem of low fertilizer utilization rate. In addition, it can realize the rapid conversion of ammonium salt in the soil and then fertilize the soil, and finally achieve accurate agriculture is of great importance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering bacteria based on glutamine synthetase and implementation method of engineering bacteria
  • Engineering bacteria based on glutamine synthetase and implementation method of engineering bacteria
  • Engineering bacteria based on glutamine synthetase and implementation method of engineering bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] This embodiment includes the following steps:

[0029] 1) Isolation and cultivation of Streptomyces grisea

[0030] Streptomyces grisea was isolated from rotten straw collected in Pujiang Town, Shanghai, and the preservation number was CGMCC No.5706. The strain was inoculated in LB liquid medium and cultured at 32°C for 48h.

[0031] The above LB liquid medium components are: peptone 10.0g / L, yeast extract 5.0g / L, NaCl 10.0g / L, pH 6.8-7.2. Add 15.0‐20.0g / L agar to the liquid medium to obtain LB solid medium.

[0032] 2) Genomic DNA extraction

[0033] Collect 2.0 mL of bacterial liquid and centrifuge at 12000 rpm for 2 min. Discard the supernatant, collect the bacterial pellet, add 180μL lysozyme (20mg / mL) and 20μL EDTA solution (0.5M, pH8.0), treat at 37℃ for 45min, add 4μL RNase A (100mg / mL), shake and mix for 15s , placed at room temperature for 5 minutes, and then completed the remaining operations according to the instructions of the bacterial DNA extraction k...

Embodiment 2

[0057] Construction of glutamine synthetase expression vector

[0058] 1) According to the glutamine synthetase sequence, design primers containing restriction sites, the sequence is as follows:

[0059] GE‐Msc I‐F:GATGGCCATGGGGAAGCGGAAGATGGACAAGCAGC

[0060] GE‐EcoR I‐R:GGAATTCTCA ATGATGATGATGATGATG CAGCACCGGCAGCAGGTTC

[0061] 2) Using Streptomyces griseorubens genomic DNA as a template, PCR amplification was performed with primers containing Msc I and EcoR I restriction sites to obtain the glutamine synthetase gene sequence, using DNA A-Tailing Kit plus A After connecting to T‐Vector PMD TM 19‐T (TaKaRa), and the ligation product was transferred into DH5α E. coli. Select positive clones on the ampicillin (50 μg / mL) resistance plate, and shake the bacteria to extract the plasmid and sequence it. If there is no mistake, Msc I and EcoR I were subjected to double enzyme digestion (37° C.), and the DNA fragment GE of the large subunit of glutamine synthetase was recovered. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses engineering bacteria based on glutamine synthetase and an implementation method of the engineering bacteria in the genetic engineering technical field. The method includes the steps of firstly, conducting PCR amplification on primers containing enzyme cutting sites with the streptomyces griseorubens genome DNA serving as a template so as to obtain glutamine synthetase encoding genes; secondly, inserting the genes into the escherichia coli expression vector pET-22b(+) to obtain a recombinant expression vector containing the glutamine synthetase encoding genes; thirdly, introducing the recombinant expression vector into escherichia coli expression bacterial strains, and conducting screening to obtain the engineering bacteria of glutamine synthetase. In order to overcome the defects that in the prior art, due to the fact that glutamine synthetase is generally endoenzyme in vivo and the expression quantity is low, the application range and the effect are seriously limited, a large amount of glutamine synthetase can be expressed and synthesized in vitro through the genetic engineering means.

Description

technical field [0001] The invention relates to a gene in the technical field of biological genetic engineering and its engineering strain, in particular to a glutamine synthetase-based engineering bacterium of Streptomyces grisea and its realization method. Background technique [0002] Nitrogen is one of the most important nutrients in the process of plant growth and development. At present, the main method to maintain or increase crop yield is to apply a large amount of fertilizer. However, the extensive application of nitrogen fertilizer not only increases the production cost of farmers, but also aggravates the eutrophication of water bodies and the emission of greenhouse gases. [0003] For crops, the ability to absorb and assimilate NO 3 － , NH 4 + and ammonia N and other nitrogen forms, but generally NO 3 － as the main source of nitrogen. NO 3 － When nitrogen source is used, nitrogen assimilation can be divided into three stages: (1) inorganic assimilation of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/70C12P13/14C12R1/19C12R1/465
Inventor 周培冯海玮孙玉静毛亮支月娥唐冬卫星罗艳青
Owner SHANGHAI JIAO TONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap