Long-acting interferon, preparation method therefor and applications thereof
An interferon, long-acting technology, applied in the direction of interferon, cytokines/lymphokines/interferon, chemical instruments and methods, etc., can solve the loss of activity of interferon beta, prolong the half-life of interferon beta, and reduce the therapeutic effect of fusion protein and other problems, to achieve the effect of simple preparation process and efficient expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Example 1 Chemical modification of recombinant human beta interferon by polysialic acid
[0046] (1) Activation of polysialic acid
[0047] ① Mix polysialic acid with freshly prepared 100mM sodium periodate at a ratio of 10mg polysialic acid / ml sodium periodate, and stir in the dark at 20°C for 5 minutes;
[0048] ② Add twice the volume of ethylene glycol to neutralize excess sodium periodate, place in a dark place at 20°C and continue stirring for 30 minutes;
[0049] ③ Dialyze the oxidized polysialic acid in 0.01% ammonium carbonate buffer (pH7.4) at 4°C for 24 hours, and the dialysis bag should be able to retain 3.5KDa molecules;
[0050] ④ Concentrated polysialic acid solution covered by dry polyethylene glycol with a molecular weight of 8KDa in reverse dialysis;
[0051] ⑤ Freeze-dry the dialysate and store it at -40°C for later use;
[0052] (2) Polysialic acid modified interferon-beta response
[0053] ① Interferon beta was diluted with 0.1% SDS pH7.4 10mM ...
Embodiment 2
[0059] Example 2 Obtaining the Gene Encoding the Fusion Protein of the Hydrophilic Non-repeating Sequence Polypeptide and Interferon-β and Constructing the Expression Vector Containing the Signal Peptide
[0060] Artificial chemical synthesis of the gene sequence encoding the fusion protein of the hydrophilic non-repeating sequence polypeptide and interferon beta, and cloning it into the pUC57 simple plasmid vector to obtain a plasmid containing the gene encoding the fusion protein;
[0061] First, use the fusion protein coding gene sequence in the plasmid as a template, and use Primer to design primers. The upstream primer is: 5'actg CCATGG CCAGCTACAACTTGCTTGGAT 3', where underlined is NCOI Restriction site; downstream primer: 5’agt CTCGAG TCATGGTGCGGTAGAAGAT 3', where underlined is wxya Restriction sites; primers were synthesized by Shanghai Sangon Bioengineering Company;
[0062] cloned by PCR NCOI and wxya The fusion protein coding gene sequence of the enzyme ...
Embodiment 3
[0070] Example 3 Construction of a gene expression vector encoding a hydrophilic non-repeating sequence polypeptide without a signal peptide and an interferon-beta fusion protein
[0071] The gene sequence encoding the fusion protein of hydrophilic non-repeating sequence polypeptide and interferon-beta was artificially synthesized chemically, and cloned into the pUC57 simple plasmid vector to obtain a plasmid containing the gene encoding the fusion protein.
[0072] First, use the fusion protein coding gene sequence in the plasmid as a template, use Primer to design primers, and the upstream primer is: 5' CATATG AGCTACAACTTGCTTGGAT 3’, where underlined is Nd Restriction site; downstream primer: 5’agt CTCGAG TCATGGTGCGGTAGAAGAT 3', where underlined is wxya Restriction sites; primers were synthesized by Shanghai Sangon Bioengineering Company.
[0073] cloned by PCR NCOI and wxya The fusion protein coding gene sequence of the enzyme cutting site was detected by 1% ag...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com