Protein-polymer combination and preparation method thereof

A technology for polymer conjugates and proteins, which is applied in the field of protein-polymer conjugates and their preparation, and can solve the problems of reduced biological activity, low reaction yield, and difficult control of binding sites and coupling stoichiometry.

Active Publication Date: 2014-12-24
TSINGHUA UNIV
View PDF1 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current PEGylated interferon has disadvantages such as low reaction yield, difficulty in controlling the binding site and conjugation stoichiometry, and severely reduced biological activity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein-polymer combination and preparation method thereof
  • Protein-polymer combination and preparation method thereof
  • Protein-polymer combination and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1: Construction of IFN-LPETGGH6 fusion protein plasmid and plasmid expressing transpeptidase Sortase A-H6 and expression in Escherichia coli.

[0059] The sequence design of IFN-LPETGGH6 is as follows (see sequence 1 of the sequence listing):

[0060] GSGGGGS LP ETGGHHHHHH

[0061] Among them, italics is the IFN sequence, LPETGGH6 is underlined and connected to IFN by GSGGGGS. The gene sequence was synthesized and inserted by Sangon Biotech (Shanghai, China) in the carrier. Using PCR technology, from Amplify the IFN-LPETGGH6 coding sequence in the vector, and insert it into the pET-25b (+) vector through Nde I and Eco RI restriction sites (such as figure 2 shown), the primers are as follows:

[0062] Upstream primer (see sequence 2 of the sequence listing):

[0063] 5' TTCCCCCATATGTGTGATCTGCCTCAGACTCATT 3'

[0064] Downstream primer (see sequence 3 of the sequence listing):

[0065] 5'TTCCCCGAATTCTTATCAATGATGATGATGATGGTGGCCACC 3'

[0066] Sub...

Embodiment 2

[0070] Embodiment 2: Purify IFN-LPETGGH by nickel affinity chromatography column 6 protein

[0071]Collect 1L of Escherichia coli culture solution in a centrifuge bottle, collect the bacteria by centrifugation at 3000×g, and remove the supernatant culture solution. The cells were resuspended in 30 mL of ice-cold PBS, and the cells were disrupted by an ultrasonic instrument at 4°C, and then the crushed E. coli products were centrifuged at 4°C and 14,000×g centrifugal force for 15 minutes. Add 2 mL polyethyleneimine (PEI, 10%) to the collected supernatant, and centrifuge again for 15 minutes, in order to remove nucleic acid and other negatively charged substances in the cell lysate. The obtained supernatant was filtered through a 0.45 μm filter membrane, and then purified on an AKTA protein purification system (AKTA Purifier 10, GE) through a nickel affinity chromatography column (HisTrap HP 5 mL), and the equilibration buffer was 10 mM PBS, 500 mM NaCl, 5% glycerol, 10mM imid...

Embodiment 3

[0073] Example 3: Introduction of ATRP initiator at the C-terminus of IFN by transpeptidase A enzyme catalysis

[0074] in the presence of IFN-LPETGGH 6 (200μM) in 50mM Tris·HCl solution (10mL) was added 5mM 2-(2-(2-(2-aminoacetamido)acetamido)acetamido)ethyl 2-bromo-2-methylpropane Ester (initiator AEBM such as Figure 4 indicated), with 100 μM transpeptidase A and 20 mM CaCl 2 Tris·HCl solution (10 mL) was mixed and reacted overnight at room temperature. Figure 5 shows that the ATRP initiator is attached to the C-terminus of IFN catalyzed by transpeptidase A, Figure 5 Among them, cysteine ​​(Cys) of transpeptidase A acts as a nucleophilic group to attack, acting on IFN-LPETGGH 6 The peptide bond between the threonine and glycine of the upper recognition sequence LPETG breaks it (acylation), thereby generating an acylase intermediate, and then the amino group of the triglycine nucleophilicly attacks the acylase, covalently linking AEBM to the on IFN-α2. After the reac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses protein-polymer combination and a preparation method thereof. The polymer is combined to the protein through an initiator connected to the protein, and the initiator can be connected to the N- end or the C- end of the protein and any position which is far away from the protein activity site and / or where the protein activity is not influenced. The interferon-polymer combination which is prepared with the method and has the specific site not only reserves bioactivity in vitro better, but also greatly improves the half-life period, bio-distribution and anti-tumor effect of interferon in vivo, so that firm technological base of is established for clinical transformation of potent interferon; and besides, the in-situ fixed-point polymerization method can further be widely applied to other protein or small peptide drugs to improve the pharmacological characteristics.

Description

technical field [0001] The invention belongs to the field of biomedicine, and in particular relates to a protein-macromolecule combination and a preparation method thereof. Background technique [0002] Proteins (such as antibodies) have been widely used in many fields such as biomedical imaging, targeted therapy, and clinical diagnosis. Using protein alone has problems such as short half-life and poor solubility. Linking proteins with polymers to prepare protein-polymer conjugates can effectively improve the solubility, stability, pharmacokinetics and therapeutic efficacy of proteins and reduce their immunogenicity. The traditional synthesis method of protein-polymer conjugates is to connect pre-prepared polymers to proteins, which often has uncertain coupling sites, low efficiency, poor yield, difficult separation of products, poor quality control, and difficult activity. Maintain and many other problems. Therefore, it is urgent to design a general method to effectively...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/555C07K1/113
CPCC07K14/555C07K14/56C07K14/565C07K14/57
Inventor高卫平胡瑾王贵林
OwnerTSINGHUA UNIV