Nitrile degradation biofilm formed genetically engineered bacterium and application of genetically engineered bacterium in nitrile-containing wastewater treatment

A genetic engineering and biofilm technology, applied in the field of bioengineering, can solve problems such as poor wastewater treatment and loss of degrading bacteria

Inactive Publication Date: 2015-01-21
NORTHEAST AGRICULTURAL UNIVERSITY
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are certain problems with this method, mainly including: ① there may be competition between pollutant-degrading bacteria and film-forming bacteria; Loss, poor wastewater treatment effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nitrile degradation biofilm formed genetically engineered bacterium and application of genetically engineered bacterium in nitrile-containing wastewater treatment
  • Nitrile degradation biofilm formed genetically engineered bacterium and application of genetically engineered bacterium in nitrile-containing wastewater treatment
  • Nitrile degradation biofilm formed genetically engineered bacterium and application of genetically engineered bacterium in nitrile-containing wastewater treatment

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0028] Example 1, the construction of genetic engineering bacterial strain Bacillus subtilis N4-pHT01-Nitr

[0029] (1) PCR amplification and subcloning of the nitrilase gene in Rhodococcus rhodochrous BX2

[0030]Using the total DNA of Rhodococcus rhodochrous BX2 as a template, the primer 5'GCG was designed according to the gene sequence of the nitrilase gene and the polyclonal restriction site of Bacillus subtilis expression vector pHT01 TCTAGA ATGGTCGAATACACAAAACAATTTC 3' and 5'ATT GACGTC TCAGATGGAGGCTGTCGC3' (the underline is followed by XbaI restriction site and AatII restriction site) is a primer to amplify the gene fragment of the nitrilase gene DNA with a length of 1101bp by PCR, and the agarose gel of the nitrilase gene Electropherogram as figure 1 As shown, 1 and 2 are the PCR products of the nitrilase gene, and M is a DNA Marker of 10,000 bp, which is consistent with the expected target fragment size. After the nitrilase gene was added with an A tail, it was co...

example 2

[0042] Example 2 Genetic engineering strain Bacillus subtilis N4-pHT01-Nitr film-forming ability

[0043] The biofilm culture device is as follows: 150mL Erlenmeyer flask containing 50mL synthetic waste water, 20 polyvinyl chloride fillers and 2 glass slides. Inoculate 1 mL of Bacillus subtilis N4-pHT01-Nitr into the biofilm culture device, and use no inoculation as the control. Set up three parallels under the same conditions and take the average value. 37°C, 60r / min shaking culture, after 4 hours of culture, add 1mM / L IPTG to Bacillus subtilisN4-pHT01-Nitr, measure the biofilm formation within 48 hours.

[0044] Described synthetic wastewater is prepared according to the following ratio: glucose 0.3g / L, NH 4 Cl 0.0401g / L, KH 2 PO 4 0.0092g / L, CaCl 2 0.0107g / L, MgSO 4 0.008g / L, FeSO 4 0.00011g / L, soluble in tap water, the amount of acetonitrile added is 800mg / L.

[0045] The biofilm biomass is determined as follows: After culturing for different times, the synthetic w...

example 3

[0047] Example 3 Degradation of acetonitrile by genetically engineered bacterial strain Bacillus subtilis N4-pHT01-Nitr

[0048] (1) Tolerance and utilization of Bacillus subtilis N4-pHT01-Nitr to acetonitrile

[0049] Inoculate 1 mL (OD 600nm =1.0) The bacterial suspension of Bacillus subtilis N4-pHT01-Nitr was placed in 50mL of synthetic wastewater containing 800mg / L acetonitrile, and the synthetic wastewater without acetonitrile was inoculated as a control, and cultured on a shaking table at 37°C at 160r / min. After culturing for 4 hours, add 1mM / L IPTG to Bacillus subtilis N4-pHT01-Nitr, measure the absorbance value at 600nm within 48 hours, observe the growth status of the strain, set up three parallels under the same conditions, and take the average value; Inoculate 1mL of Bacillus subtilis N4-pHT01-Nitr bacterial suspension in 50mL inorganic salt basal medium containing 800mg / L acetonitrile, take the medium without inoculation as the control, shake at 37°C and 160r / min ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Effective volumeaaaaaaaaaa
Login to View More

Abstract

The invention provides a nitrile degradation biofilm formed genetically engineered bacterium and application of the genetically engineered bacterium in nitrile-containing wastewater treatment, and belongs to the bioengineering technology. The genetically engineered bacterium Bacillus subtilis N4-pHT01-Nitr with the preservation number of CGMCC No.9484 is preserved in the China General Microbiological Culture Collection Center on July 25, 2014. The bacterium is prepared by inserting a nitrilase gene in Rhodococcus rhodochrous BX2 into Bacillus subtilis N4 for expressing by means of gene engineering. The bacterium is capable of generating a biofilm and degrading acetonitrile, the OD570nm value of biofilm formation capacity is 1.45 when the bacterium is culture in synthetic wastewater at 37 DEG C and 60r / min for 48 hours; and the residual concentration of acetonitrile is 23.56mg / L after the bacterium is oscillated and cultured in 800mg / L acetonitrile-containing synthetic wastewater at 37 DEG C and 160rpm for 48 hours. The bacterium has strong acetonitrile impact resistance, acetonitrile in synthetic wastewater is reduced from 800mg / L to 0.32mg / L when the wastewater is output, and the COD value of the synthetic wastewater is reduced from 487mg / L to 16.39mg / L when the wastewater is output. The bacterium provides a novel method to nitrile-containing wastewater treatment by utilizing a biofilm method.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and mainly relates to a nitrile-degrading-biofilm-forming bifunctional genetic engineering bacterium and its application in the treatment of nitrile-containing wastewater. Background technique [0002] Acetonitrile is an organic chemical raw material containing cyano group (R-CN), which is widely used in pharmaceutical, synthetic fiber, petrochemical and other fields, and is one of the main components in nitrile-containing wastewater. When acetonitrile in nitrile-containing wastewater enters natural waters, it will cause a large number of aquatic organisms such as fish to die, and cause serious damage to the ecological environment. Acetonitrile can enter the body through inhalation, ingestion, and skin absorption, and transforms into highly toxic substances in the body—hydrogen cyanide and acetaldehyde, threatening the health of humans and animals. Nitrilase is one of the important degrad...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C02F3/34C12R1/125C02F101/38
CPCC12N9/78C02F3/34C02F2101/38C12Y305/05001
Inventor李春艳成毅杨亚丽岳振雷冯凤兆徐春红黄馨凝侯宁安雪姣成小松
OwnerNORTHEAST AGRICULTURAL UNIVERSITY