Alkaline xylanase mutant and application thereof

A technology of xylanase mutation and xylanase, which is applied in the field of alkaline xylanase mutants, can solve problems such as limitations, and achieve the effects of improving whiteness, reducing environmental pollution, and reducing use

Active Publication Date: 2015-03-25
QINGDAO VLAND BIOTECH GRP +1
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the paper industry, the pulp cooking and bleaching processes are basically carried out under high temperature and strong alkali conditions, which greatly restricts the existing acidic or neutral xylanase products.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Alkaline xylanase mutant and application thereof
  • Alkaline xylanase mutant and application thereof
  • Alkaline xylanase mutant and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Embodiment 1 Amplification of xylanase gene

[0019] According to the gene sequence in the public gene database, the codon of the synthetic gene was optimized and the alkaline xylanase gene XynA1 (sequence is SEQ ID NO: 2) was artificially synthesized, and the amino acid sequence encoded by it was SEQ ID NO: 1.

[0020] The alkaline xylanase gene XYNA1 fragment was cloned by PCR reaction, and the primers and reaction conditions were as follows:

[0021] Primer 1 (F): GCGCGAATTCGCTATTACTTCTAACGAGAT

[0022] Primer 2 (R): TAAAGCGGCCGCTTATCTAATTTCCAAGTAAT

[0023] The reaction conditions were: denaturation at 94°C for 30s, renaturation at 56°C for 30s, extension at 72°C for 1min, and after 30 cycles, incubation at 72°C for 10min. The results of agarose electrophoresis showed that the XynA1 gene was a 984bp fragment.

Embodiment 2

[0024] Example 2 Construction and Screening of Xylanase Mutants

[0025] In order to improve the heat resistance and optimal reaction pH of xylanase XynA1 derived from Bacillus, a large number of mutations of the enzyme were screened by directed evolution technology.

[0026] Using the XynA1 gene as a template, use primers 1 and 2 to perform PCR amplification with the GeneMorph II Random Mutation PCR Kit (Stratagene), recover the PCR product from the gel, perform enzyme digestion with EcoRI and NotI, and then ligate it to the pET21a vector after the same enzyme digestion , transformed into Escherichia coli BL21(DE3), spread on LB+Amp plates, and culture them upside down at 37°C. After the transformants appeared, pick them one by one with a toothpick to a 96-well plate, and add 150ul of 0.1mM IPTG to each well. LB+Amp culture medium, cultured at 37°C and 220 rpm for about 6 hours, centrifuged to discard the supernatant, resuspended the bacteria with pH 8.0 buffer, and repeatedl...

Embodiment 3

[0030] Example 3 Construction of Pichia pastoris engineering strain

[0031] The xylanase mutant gene XynT6 fragment cloned above was connected to the expression vector pPIC9K through the EcoR I and Not I sites to construct the expression vector pPIC9K-XynT6.

[0032] The expression plasmid pPIC9K-XynT6 was linearized with Sal I, and the linearized fragment of the expression plasmid was transformed into Pichia pastoris GS115 by electroporation, and the recombinant strain of Pichia pastoris GS115 / pPIC9K-XynT6 was obtained by screening on the MD plate, and then mixed with different concentrations of Multi-copy transformants were screened on Geneticin YPD plates.

[0033] One transformant named Pichia pastoris XynT6 (Pichia pastoris XynT6), was transferred to BMGY medium, 30°C, 250rpm shaking culture for 1d; then transferred to BMM medium, 30°C, 250rpm shaking culture; adding 0.5 % methanol, induced expression for 4 days; centrifuged to remove the bacteria, to obtain the ferment...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
whitenessaaaaaaaaaa
Login to View More

Abstract

The invention provides an alkaline xylanase mutant and application thereof. Protein engineering modification is performed on the xylanase derived from bacillus to obtain a mutant protein; the heat resistance and the optimum reaction pH of the mutant protein are remarkably increased, and therefore, the mutant protein can be widely applied to the field of papermaking. The amino acid sequence of the xylanase mutant is SEQ ID NO: 3. The optimum pH of the xylanase mutant XynT6 is 9.0; more than 75% of enzyme activity can be kept within the pH range of 7.0-10.0, and the enzyme activity level of the mutant under the alkaline condition is obviously higher than that of a wild type; the optimum operation temperature of the xylanase mutant XynT6 is 60 DEG C, and about 80% of enzyme activity of the xylanase mutant XynT6 still can be kept under the condition of 65 DEG C, and therefore, the xylanase mutant XynT6 has better heat resistance than the wild type. The xylanase mutant XynT6 is capable of effectively improving the whiteness of the paper pulp, advantageous for a papermaking enterprise to improve the paper pulp bleaching process, reduce the use of a chemical bleaching agent and reduce the environmental pollution, and wide in prospect.

Description

technical field [0001] The invention belongs to the technical field of functional gene modification, and specifically relates to an alkaline xylanase mutant and application thereof. technical background [0002] Xylanase refers to the general term of a group of enzymes that can specifically degrade hemicellulose xylan into xylooligosaccharides and xylose. It has been widely used in the fields of feed, baking, beer, paper, textile, medicine and energy. Especially in the pulp bleaching process, the application of xylanase can reduce the amount of chlorine-containing compounds, promote the degradation of residual lignin in pulp and the extraction of soluble lignin, not only can improve the whiteness and whiteness stability of pulp , improve the water filterability and papermaking performance of fibers, and can reduce the amount of subsequent process chemicals and reduce the discharge of chloride-rich industrial wastewater, which is very realistic for effectively reducing envir...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/42C12N15/56C12N15/81D21C9/10C12R1/84C12R1/07
CPCC12N9/248D21C9/10
Inventor徐晓东李冬冬肖志壮王海
OwnerQINGDAO VLAND BIOTECH GRP