Salt-resistant proteinase-resistant alpha-galactosidase AgaAHJ8 and gene thereof

[0033] Example 1: Cloning of α-galactosidase gene agaAHJ8

[0034] Extraction of marine bacillus genomic DNA: Centrifuge the bacteria liquid cultured for 2 days to collect the bacteria, add 1 mL of lysozyme, treat at 37°C for 60 minutes, and then add the lysis solution. The composition of the lysis solution is: 50mM Tris, 20mM EDTA, 500mM NaCl, 2% w/v) SDS, pH8.0, 70℃ water bath lysis for 60min, mixing every 10min, centrifugation at 10000rpm at 4℃ for 5min. The supernatant was extracted in phenol/chloroform to remove impurities, and then the supernatant was added to an equal volume of isopropanol. After standing at room temperature for 5 minutes, centrifuged at 10,000 rpm for 10 minutes at 4°C. The supernatant was discarded, the precipitate was washed twice with 70% ethanol, dried in vacuum, dissolved in an appropriate amount of TE, and placed at -20°C for use.

[0035] Use the ultrasonic interrupter Biorupter to break 5μg of the marine bacillus genome into 400-600bp fragments, use Genomic DNA Clean&Concentration kit to purify the broken DNA fragments, after purification, use TureseqTM DNA Sample Preparation Kit to carry out the end of the DNA fragments. Adding A bases and adaptors to the flat and 3'ends, and PCR amplification of DNA fragments (operate according to the kit instructions). Genomic sequencing was performed on the library prepared above with MiSeq Genome Sequencer (Illumima Company).

[0036] The data obtained by genome sequencing is predicted by reading frame and local BLAST comparison, and the α-galactosidase gene agaAHJ8 is obtained. The gene sequence is shown in SEQ ID NO.2.

[0037] Example 2: Preparation of recombinant α-galactosidase AgaAHJ8

[0038] PCR amplification was performed with 5'CAACAGAAGGCATCCCTTGCCCCC 3'and 5'GATCTTTTTGAGGCGGAAAAGCTTTG 3'as a primer pair, and marine bacillus genomic DNA as a template. The PCR reaction parameters were: denaturation at 94°C for 5 min; then denaturation at 94°C for 30 sec, annealing at 65°C for 30 sec, extension at 72°C for 2 min 30 sec, and after 30 cycles, at 72°C for 10 min. As a result of PCR, the α-galactosidase gene agaAHJ8 was obtained, and the protruding A base was introduced at the 3'end of the gene. The α-galactosidase gene agaAHJ8 and the expression vector pEasy-E2 were connected by T-A to obtain the recombinant expression plasmid pEasy-E2-agaAHJ8 containing agaAHJ8. The pEasy-E2-agaAHJ8 was transformed into E. coli BL21 (DE3) to obtain the recombinant E. coli strain BL21 (DE3)/agaAHJ8.

[0039] Take the recombinant E. coli strain BL21(DE3)/agaAHJ8 containing the recombinant plasmid pEasy-E2-agaAHJ8 and inoculate it in LB (containing 100μg mL -1 Amp) In the culture medium, shake quickly at 37°C for 16 hours. Then the activated bacterial solution was inoculated into fresh LB (containing 100μg mL -1 Amp) culture medium, fast shaking culture for about 2-3h (OD 600 After reaching 0.6-1.0), add IPTG with a final concentration of 0.1 mM for induction, and continue shaking culture at 20°C for about 20 hours or 26°C for about 8 hours. Centrifuge at 12000 rpm for 5 min to collect the bacteria. After suspending the bacteria in an appropriate pH 7.0 Tris-HCl buffer, ultrasonically disrupt the bacteria in a low temperature water bath. After centrifugation of the above concentrated crude enzyme solution at 13,000 rpm for 10 minutes, the supernatant was aspirated and the target protein was affinity and purified with Nickel-NTA Agarose and 0-500 mM imidazole, respectively. SDS-PAGE results ( figure 1 ) Showed that the recombinant α-galactosidase AgaAHJ8 was expressed in E. coli, and after purification, the product was a single band.

[0040] Example 3: Determination of the properties of purified recombinant α-galactosidase AgaAHJ8

[0041] 1. Activity analysis of purified recombinant α-galactosidase AgaAHJ8

[0042] The activity determination method of the purified recombinant α-galactosidase AgaAHJ8 adopts the pNPG method: pNPG is dissolved in 0.1M buffer to make the final concentration 2mM; the reaction system contains 50μL appropriate enzyme solution, 450μL of 2mM substrate; After preheating the substance for 5 minutes at the reaction temperature, add enzyme solution and react for 10 minutes, then add 2mL 1M Na 2 CO 3 The reaction was terminated, and the released pNP was measured at a wavelength of 405nm after cooling to room temperature; 1 unit of enzyme activity (U) was defined as the amount of enzyme required to decompose pNPG to produce 1 μmol pNP per minute. The method for determining the activity of the substrate raffinose and guar gum adopts the DNS method: the substrate is dissolved in 0.1M buffer to make the final concentration 0.5%; the reaction system contains 50μL of enzyme solution and 450μL of substrate; After preheating for 5 minutes at the reaction temperature, add enzyme solution and react for an appropriate time, then add 2.0mL DNS to terminate the reaction, boil for 5 minutes, cool to room temperature and measure the OD value at 540nm wavelength; 1 enzyme activity unit (U) It is defined as the amount of enzyme required to decompose the substrate to produce 1 μmol of reducing sugar (calculated as galactose) per minute under the given conditions. The glucose oxidase method is used to determine the activity of the substrate denbiose: the substrate is dissolved in 0.1M buffer to make the final concentration 0.5% (w/v); the reaction system contains 50μL appropriate amount of enzyme solution, 450μL bottom Substance; After the substrate is preheated at the reaction temperature for 5 minutes, the enzyme solution is added and then reacted for 10 minutes, and then according to the principle of glucose oxidase-peroxidase method, the glucose determination kit (Shanghai Rongsheng Biopharmaceutical Co., Ltd., CAT361500 ) The manual measures the enzyme activity; 1 unit of enzyme activity (U) is defined as the amount of enzyme required to decompose the substrate to produce 1 μmol of glucose per minute under the given conditions.

[0043] 2. Determination of pH activity and pH stability of purified recombinant α-galactosidase AgaAHJ8:

[0044] Determination of the optimal pH of the enzyme: the α-galactosidase AgaAHJ8 was subjected to the enzymatic reaction at 37°C and 0.1M pH3.0–10.0 buffer. Determination of the pH stability of the enzyme: Place the enzyme solution in a 0.1M pH3.0–10.0 buffer solution, treat it at 37°C for 1h, and then perform the enzymatic reaction at pH5.5 and 37°C to use the untreated enzyme As a control. The buffer is: 0.1M McIlvaine buffer (pH3.0–8.0) and 0.1M glycine–NaOH (pH9.0–10.0). Using pNPG as a substrate, react for 10 minutes to determine the enzymatic properties of the purified AgaAHJ8. The results show that the optimum pH of AgaAHJ8 is 5.5, and it maintains more than 72% of the enzyme activity in the range of pH 4.0-8.0 ( figure 2 ); After pH4.0-8.0 buffer solution at 37℃ for 1h, the remaining enzyme activity reaches more than 73% ( image 3 ).

[0045] 3. Determination of thermal activity and thermal stability of purified recombinant α-galactosidase AgaAHJ8:

[0046] Enzyme thermal activity determination: Enzymatic reaction is carried out in a buffer of pH 5.5 at 10–70°C. Enzyme thermostability determination: put the enzyme solution with the same amount of enzyme at 37°C and 50°C respectively, and after treatment for 0-60 minutes, perform the enzymatic reaction at pH 5.5 and 37°C, and use the untreated enzyme solution as a control . Using pNPG as a substrate, react for 10 minutes to determine the enzymatic properties of the purified AgaAHJ8. The results show that the optimum temperature of AgaAHJ8 is 50℃( Figure 4 ); The enzyme is stable at 37°C, with a half-life of less than 5min at 50°C ( Figure 5 ).

[0047] 4. Determination of kinetic parameters of purified recombinant α-galactosidase AgaAHJ8:

[0048] Enzyme kinetic parameters first-level reaction time determination: at pH 5.5 and 50 ℃, with 1 mM pNPG or 14 mM denbiose as a substrate, the reaction is terminated within 1-30 min of the enzymatic reaction and the enzyme activity is determined. Calculate the ratio of enzyme activity to reaction time. If the ratio remains stable for a certain period of time, this time is the first-order reaction time. Use 0.05–2.0mM pNPG or 2.9–36.5mM denbiose as the substrate, and determine K according to the Lineweaver–Burk method at pH 5.5, 50°C and first-order reaction time m , V max And k cat. It has been determined that at 50℃ and pH5.5, AgaAHJ8 has an effect on the K of pNPG m , V max And k cat Respectively 2.0mM -1 , 111.1μmol min -1 mg -1 And 83.2s -1 , The K for mibiose m , V max And k cat 13.2mM respectively -1 , 0.9μmol min -1 mg -1 And 0.7s -1.

[0049] 5. The influence of different metal ions and chemical reagents on the activity of purified recombinant AgaAHJ8:

[0050] Add 1.0mM metal ions and chemical reagents to the enzymatic reaction system to study its effect on enzyme activity. At 37°C and pH5.5, pNPG was used as a substrate to measure enzyme activity. The results (Table 1) show that 1.0mM SDS, HgCl 2 And AgNO 3 It can completely or almost completely inhibit AgaAHJ8; other metal ions and chemical reagents have little effect on AgaAHJ8.

[0051] Table 1. The effect of metal ions and chemical reagents on the activity of purified recombinant α-galactosidase AgaAHJ8

[0052]

[0053] 6. Activity of purified recombinant α-galactosidase AgaAHJ8 in NaCl:

[0054] Determination of enzyme activity in NaCl: Add 3.5-30.0% (w/v) NaCl to the enzymatic reaction system, and perform the enzymatic reaction at pH 5.5 and 37°C. Using pNPG as a substrate, react for 10 minutes to determine the enzymatic properties of the purified AgaAHJ8. The results showed that: AgaAHJ8 has good salt tolerance, adding 3.5-30.0% (w/v) NaCl to the reaction system, the enzyme still has more than 70% enzyme activity ( Image 6 ).

[0055] 7. Determination of protease resistance of purified recombinant α-galactosidase AgaAHJ8:

[0056] Protease resistance of the enzyme: Treat the recombinase with trypsin (pH 7.5) and proteinase K (pH 7.5) equivalent to 45 times (w/w) of the recombinase at 37°C for 1 h, and then at pH 5.5 and 37 The enzymatic reaction was carried out at ℃, and the enzyme solution placed in the pH buffer solution corresponding to the protease but without protease was used as a control. The results showed that after trypsin and proteinase K were treated at 37°C for 1 h, AgaAHJ8 could still maintain 101.1% and 108.9% of the enzyme activity, respectively.

[0057] 8. Degradation of substrate by purified recombinant α-galactosidase AgaAHJ8:

[0058] At pH5.5 and 50℃, the specific activity of this enzyme to 2mM pNPG is 43.5±1.0U mg -1 , The specific activities of 0.5% (w/v) melibiose, raffinose and guar gum are 0.47±0.07, 1.93±0.07 and 0.46±0.06 U mg, respectively -1.