Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Method for synthesizing ferulic acid through enzyme method

A technology of enzymatic synthesis and ferulic acid, which is applied in the directions of transferase, introduction of foreign genetic material using a carrier, recombinant DNA technology, etc., can solve the problems of high cost, low yield and long reaction time, and achieves mild reaction conditions and transformation. The effect of high efficiency and low conversion cost

Inactive Publication Date: 2015-08-05
SOUTHWEST JIAOTONG UNIV
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the reaction time of this method is too long, it is easy to produce cis-trans mixture, the solvent consumption is large, and the productive rate is low
The second category is to use different extraction methods to extract from different materials. For example, the industry mainly uses the alkaline method to decompose γ-oryzanol in rice bran to produce high-purity ferulic acid, but this method has low yield, environmental pollution and high cost. Restricted large-scale production and application of ferulic acid

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for synthesizing ferulic acid through enzyme method
  • Method for synthesizing ferulic acid through enzyme method
  • Method for synthesizing ferulic acid through enzyme method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Embodiment 1: Construction of pET28a-COMT recombinant plasmid:

[0028] 1. The pET28a plasmid is a Novagen product, with a size of 5369bp, containing a strong T7 promoter, a kanamycin resistance gene, and a lactose repressor lac I gene.

[0029] 2. Design two expression primers (A1: CGCGGATCCATGAATACGGAGCTGATCCCACC; A2: CGGAATTCACATTAAGCAGATGCCAGACACCC) containing the complete reading frame of Chuanxiong COMT and BamH1 in the forward direction and EcoR1 in the reverse direction. Ligusticum chuanxiong COMT fragment containing two restriction sites of BamH1 and EcoR1 at the end. The PCR system is: Primer star mix (Bao Biological Company) 25ul, cDNA 2ul, primer 1 2ul, primer 2 2ul, double distilled water to make up 50ul. The PCR system was 94°C for 5min, 94°C for 1min, 66-68°C for 1min, 72°C for 2min, 35 cycles, 72°C for 10min, 4°C∞.

[0030] 3. After the gel was recovered, the amplified COMT fragment of Ligusticum chuanxiong and the pET28a vector were double-digested wi...

Embodiment 2

[0035] Embodiment 2: the fermentation of recombinant bacterial strain:

[0036] 1. Inoculate 1ml of the overnight cultured recombinant strain into 100ml of LB liquid medium containing 10g / L peptone, 5g / L yeast extract, 10g / L NaCl, 50mg / L kanamycin, in a 500ml Erlenmeyer flask at 37°C, Cultivate at 200 rpm for 2-4 hours to obtain seed liquid.

[0037] 2. Inoculate 5ml of seed liquid into 100ml of LB liquid medium, cultivate at 37°C and 200rpm until OD OD600=0.6. Add IPTG to make the final concentration 1mM / L, culture at 17-20°C, 200rpm for 8-10h.

Embodiment 3

[0038] Embodiment 3: the enzymatic conversion of ferulic acid

[0039] 1. Centrifuge the obtained fermentation broth at 5000g for 10min at 4°C to collect the bacterial cells.

[0040] 2. Resuspend the cells with 10ml of 20mM Tris-Hcl pH7.9 buffer, and lyse the cells by ultrasonication. The ultrasonic program was 60W, working for 9s, pausing for 6s, repeated 199 times under ice bath conditions. Centrifuge at 13000g at 4°C to remove cell debris. The supernatant was collected to obtain a mixed enzyme solution containing COMT of Ligusticum chuanxiong.

[0041] 3. Reaction system: 500uM caffeic acid, 1mM SAM, 100mM MgCl2, 1mM DTT, 100mM potassium phosphate buffer 100ml, 1-5ml mixed enzyme solution.

[0042] 4.37 ℃ stand for 6 ~ 8h. Add 5-10ml of concentrated HCl to terminate the reaction.

[0043] 5. Extract 3 times with ethyl acetate to obtain ferulic acid crude extract.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a method for synthesizing ferulic acid through an enzyme method, wherein the methyl on S-adenosyl methionine (SAM) is transferred onto caffeic acid so as to finally form the product ferulic acid. The method comprises: a) highly expressing ligusticum chuanxiong hort caffeic acid-O methyltransferase(COMT) through fermentation of escherichia coli, collecting bacteria through centrifugation, re-suspending the bacteria with a Tris-HCl buffer solution, and carrying out ultrasonic bacterial lysis to obtain a mixed enzyme solution containing the ligusticum chuanxiong hort COMT; and b) transferring the methyl provided by SAM to the caffeic acid through the ligusticum chuanxiong hort COMT obtained in the step a), and finally converting into the ferulic acid. The method of the present invention has advantages of simple process, mild reaction condition, high conversion efficiency, low conversion cost, and the like.

Description

Technical field: [0001] The invention belongs to the field of bioengineering applications, in particular to the construction of a genetically engineered strain of recombinant E. Enzymatic conversion method of ferulic acid into ferulic acid. Background technique: [0002] Ferulic acid is a phenolic acid ubiquitous in the plant kingdom, and its chemical name is 4-hydroxy-3-methoxycinnamic acid. It has many health functions, such as scavenging free radicals, antithrombotic, antibacterial and anti-inflammatory, inhibiting tumors, preventing hypertension, heart disease, enhancing sperm motility, inhibiting human epidermal melanocyte proliferation, melanin synthesis and tyrosinase activity, etc. Used in the field of key cosmetics. Ferulic acid is mainly used in the food industry to prepare natural vanillin, antioxidants, preservatives, cross-linking agents and function accelerators. At the same time, ferulic acid has low toxicity and is easy to be metabolized by the human body. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P7/42C12N9/10C12N15/70
CPCC12P7/42
Inventor 廖海周嘉裕张赶李娟娟俞继华李洋洋黄新河
Owner SOUTHWEST JIAOTONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com