Vitreoscilla hemoglobin mutant and controllable expression of vitreoscilla hemoglobin mutant in genetically engineered bacteria

A technology for hemoglobin and Vibrio vitreous bacteria, which is applied in genetic engineering, hemoglobin/myoglobin, plant genetic improvement, etc., can solve the problems of difficulty in meeting oxygen, complex α-amylase synthesis pathway, and consumption of a large amount of oxygen, so as to improve utilization efficiency, increase output, and reduce material loss

Active Publication Date: 2016-02-24
SHANDONG LONGKETE ENZYME PREPARATION
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Aiming at the complex synthetic pathway of mesophilic α-amylase in Bacillus subtilis, a large amount of oxygen needs to be consumed in the fermentation process, and the energy ATP is generated by oxidizing NAD(P)H or FADH to form NAD(P) or FAD to maintain cell metabolism, relying solely on power Oxygen supply is difficult to meet its demand for oxygen

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vitreoscilla hemoglobin mutant and controllable expression of vitreoscilla hemoglobin mutant in genetically engineered bacteria
  • Vitreoscilla hemoglobin mutant and controllable expression of vitreoscilla hemoglobin mutant in genetically engineered bacteria
  • Vitreoscilla hemoglobin mutant and controllable expression of vitreoscilla hemoglobin mutant in genetically engineered bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Codon optimization and site-directed mutagenesis were performed on the hemoglobin gene sequence of Vitiligo hyaline to obtain the sequence.

[0040] According to the Vibrella hyaline hemoglobin gene sequence (as shown in SEQIDNO: 1) and Bacillus subtilis codon preference in GenBank, use software CodonW software package to analyze gene structure and site-directed mutagenesis kit, select certain sites to carry out site-directed mutagenesis and After codon optimization, the gene sequence was preliminarily determined by analyzing CAI, CBI, and Nc values. Analyze the mRNA free energy by RNAstructure, combine the preferred codons of Bacillus subtilis, and finally select the modification scheme with lower free energy, and design the codons with the preferred codons of Bacillus subtilis after adding the restriction sites of BamH1 and Sal1 at both ends of the sequence The hemoglobin mutant gene sequence of Vitiligo hyaline (as shown in SEQ ID NO: 2), and then this gene sequence ...

Embodiment 2

[0042] Construction of the hemoglobin gene expression vector PBE-Pxyl–vgh containing codon-optimized and site-directed mutations and the acquisition of recombinant strains (Bacillus subtilis / PBE-Pxyl-vgb).

[0043] Build process like figure 2 As shown, the xylose promoter Pxyl fragment on the plasmid pAX01 was amplified with primers Y1 (containing the EcoR1 restriction site) and Y2, and the primer sequences were as follows:

[0044] Y1: CCGGAATTCAACCATTTGCTGTTGCTTGA (SEQ ID NO: 5),

[0045] Y2: CGCCAATGCTTGTCACGAATATAAGATA (SEQ ID NO: 6);

[0046] The PCR reaction system and procedures are as follows:

[0047]

[0048] The transcription termination signal sequence on the plasmid pAX01 was amplified with primers Y3 and Y4 (containing HindIII restriction sites), and the primer sequences were as follows:

[0049] Y3: CTTATATTCGTGACAAGCATTGGCGATCGGCTGTTTGG (SEQ ID NO: 7),

[0050] Y4: CCCAAGCTTTCCCCCTACTGCGTGTCGTA (SEQ ID NO: 8);

[0051] The PCR reaction system and proce...

Embodiment 3

[0081] The expression of hemoglobin was detected by carbon monoxide differential light spectroscopy.

[0082]After culturing the original bacteria and the recombinant bacillus overnight, inoculate them in 60ml of fermentation medium with 1% by volume, and culture them with shaking at 37°C for 12h (wherein 3% xylose is added at 7h to induce codon-optimized Vibrella hyaline The expression of bacterium), take 15mL bacterium liquid, 8000r / min, after 10min centrifugation collects thalli, after washing three times with 50mM, the potassium phosphate buffer of pH7.0, resuspend in 10mL potassium phosphate buffer. Under the condition of ice bath, the bacterial suspension was ultrasonically oscillated with an action time of 25s and an interval of 50s to break up the cells. Add 20 mg of sodium dithionite per milliliter to the bacterial suspension of broken cells, and then divide it into 2 parts of equal volume. One part is fed with carbon monoxide gas for 5 minutes as a sample, and the ot...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses recombination bacillus subtilis of a vitreoscilla hemoglobin mutant gene with optimized controllable expression codon and and application thereof. A strain is the recombination bacillus subtilis / PBE-Pxyl-vgb, and the collection number is CGMCC No.10787. A bacillus subtilis expression carrier PBE-Pxyl-vgb is constructed through the vitreoscilla hemoglobin mutant gene vgh with the optimized codon; the expression carrier PBE-Pxyl-vgb is electrically transferred into bacillus subtilis, and the recombination bacillus subtilis (PBE-Pxyl-vgb) is obtained. When intermediate temperature alpha-amylase is produced with the strain, xylose is added or not added according to the requirements in the practical fermentation process to start or stop the expression of vitreoscilla hemoglobin, the controllable expression of the vitreoscilla hemoglobin gene is achieved, excessive consumption, caused by the continuous expression of the vitreoscilla hemoglobin, of nutrient substances in fermentation liquor and oxygen is avoided, and therefore the oxygen use efficiency of the recombination bacillus subtilis is improved. The result shows that the intermediate temperature alpha-amylase fermentation level of the recombination bacillus subtilis is increased by 303% compared with an original strain.

Description

technical field [0001] The invention relates to a controllable-expressed Vitillaria hemoglobin mutant and its recombinant Bacillus subtilis and its application. The codon-optimized Vitiligo hyaline hemoglobin mutant gene is induced to express with xylose in Bacillus subtilis, thereby improving the The invention relates to the ability of recombining bacillus subtilis cells to absorb oxygen to improve the production of mesophilic alpha-amylase, which belongs to the technical field of genetic engineering. Background technique [0002] Medium temperature α-amylase is an amylase preparation refined by Bacillus subtilis through liquid submerged fermentation and post-extraction technology. This enzyme takes calcium ion as an essential factor and acts as a stabilizing factor and an activating factor, and some amylases are calcium ion-independent. This enzyme acts on both amylose and amylopectin. It randomly cuts the α-1,4 glycosidic bonds inside the sugar chain without distinction,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/805C12N15/31C12N15/75C12N1/21C12N9/28C12R1/125
CPCC07K14/805C12N9/2417C12N15/75C12Y302/01001
Inventor王兴吉郭庆文佟新伟
OwnerSHANDONG LONGKETE ENZYME PREPARATION