Unlock instant, AI-driven research and patent intelligence for your innovation.

Bacillus n311 from Antarctica and its application in controlling plant pathogenic fungi

A bacillus, plant pathogenic technology, applied in the direction of application, plant growth regulator, and microbial-based methods, can solve the problems of plant pathogenic bacteria resistance, ecological environment and human health hazards, and achieve good biological control effect, inhibit The effect of wide fungal spectrum and simple preparation process

Active Publication Date: 2019-02-05
THIRD INST OF OCEANOGRAPHY STATE OCEANIC ADMINISTATION
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, due to the extensive use of chemical pesticides, it not only brings about the problem of resistance of plant pathogenic bacteria, but also causes potential harm to the ecological environment and human health.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus n311 from Antarctica and its application in controlling plant pathogenic fungi
  • Bacillus n311 from Antarctica and its application in controlling plant pathogenic fungi
  • Bacillus n311 from Antarctica and its application in controlling plant pathogenic fungi

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: Isolation and screening of Bacillus sp. N311

[0026] The present invention relates to Bacillus sp. N311, which is obtained by screening from the seawater samples collected by the applicant from China's 31st Antarctic scientific expedition. The bacterium grows on LB medium, and after 24 hours of culture at 28°C, the bacterium is pale yellow, the surface of the colony is rough and dry, and the edges are irregular, see figure 1 .

Embodiment 2

[0027] Embodiment 2: Bacillus sp. (Bacillus sp.) N311 strain identification

[0028] The 16S rDNA universal primers 27F and 1492R (27F: AGAGTTTGATCCTGGCTCAT; 1492R: ACGGCTACCTTGTTACGACTT) were used to amplify the rDNA sequence of the Antarctic strain N31116S. The total DNA of N311 was used as the PCR amplification template, and the PCR reaction was carried out on a PCR amplification instrument. The reaction conditions were: denaturation at 94°C for 1 min; annealing at 55°C for 1 min; extension at 72°C for 1.5 min, 30 cycles. After the amplified sequence was sequenced by a sequencing company, the 16S rDNA sequence of the strain was obtained. The sequence was compared with the nucleic acid data in GenBank of the National Center for Biotechnology Information (http: / / ncbi.nlm.nih.gov / blast). The results showed that the 16S rDNA sequence of N311 had 99% sequence similarity with Bacillus methylotrophicus (HQ662596.1), Bacillus amyloliquefaciens (JF460737.1), and Bacillus amyloliqu...

Embodiment 3

[0029] Embodiment 3: the mensuration of phytopathogenic fungi antimicrobial spectrum

[0030] The inhibitory activity of Bacillus sp. N311 against 10 plant pathogenic fungi was determined by disc method. Use a sterile puncher to make the test pathogenic fungus into a bacterial block, pick a bacterial block with a toothpick and inoculate it in the center of the potato solid medium plate, and cultivate it under the condition of 28°C. After the mycelium of the pathogenic fungus to be tested spreads and grows, a sterilized double-layer filter paper sheet (diameter 6 mm) is placed around the bacterial block, and the filter paper sheet is about 1 cm away from the edge of the mycelium. Add 50 μL of sterile fermentation supernatant to each filter paper sheet, and continue to cultivate for 24 hours. By comparing with the control group, observe whether the growth of mycelium will be inhibited. If the mycelium of the tested pathogenic fungus is inhibited, the bacteria The filaments will...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Antarctic-sourced bacillus N311 and its application in controlling plant pathogenic fungi involve bacillus. The deposit number of the Bacillus sp. N311 is CCTCC NO: M 2015607. The bacillus N311 can be used to prepare the fermentation supernatant for controlling plant pathogenic fungi. The phytopathogenic fungi controlled by the bacillus include Fusarium, Banana Anthracnose, Paecilomyces variotii, Sclerotinia, Alternaria longophyllum, Trichoderma viride, Rhizoctonia solani, Alternaria alternata, Cinerea Mold, Gleosporin anthracnose. It has good biological control effect in the potted control test of rape sclerotinia, and the control effect reaches more than 50%. The fermentation supernatant of Bacillus N311 has a broad antifungal spectrum, good biocontrol effect, and has the advantages of non-toxicity, not easy to produce drug resistance, environmental and biological safety, etc., and has broad application prospects.

Description

technical field [0001] The invention relates to a bacillus, in particular to a bacillus N311 and its application in preparing a fermentation supernatant for preventing and controlling plant pathogenic fungi. Background technique [0002] Plant disease is an important factor that seriously threatens agricultural production. According to the statistics of the Food and Agriculture Organization of the United Nations (FAO), the average annual production loss caused by plant disease is 10% to 15% of the total output. At present, due to the extensive use of chemical pesticides, it not only brings about the problem of resistance of plant pathogenic bacteria, but also causes potential harm to the ecological environment and human health. The development of broad-spectrum, high-efficiency, and low-toxicity biological pesticides has become a common goal of researchers and pesticide users (Calvo J, Calvente V, et al.2007). [0003] In recent years, the discovery of active substances wit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/20A01N63/02A01P3/00C12R1/07
CPCA01N63/10C12N1/205C12R2001/07
Inventor 陈新华吴小君郭文斌
Owner THIRD INST OF OCEANOGRAPHY STATE OCEANIC ADMINISTATION
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More