Bacillus n311 from Antarctica and its application in controlling plant pathogenic fungi
A bacillus, plant pathogenic technology, applied in the direction of application, plant growth regulator, and microbial-based methods, can solve the problems of plant pathogenic bacteria resistance, ecological environment and human health hazards, and achieve good biological control effect, inhibit The effect of wide fungal spectrum and simple preparation process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1: Isolation and screening of Bacillus sp. N311
[0026] The present invention relates to Bacillus sp. N311, which is obtained by screening from the seawater samples collected by the applicant from China's 31st Antarctic scientific expedition. The bacterium grows on LB medium, and after 24 hours of culture at 28°C, the bacterium is pale yellow, the surface of the colony is rough and dry, and the edges are irregular, see figure 1 .
Embodiment 2
[0027] Embodiment 2: Bacillus sp. (Bacillus sp.) N311 strain identification
[0028] The 16S rDNA universal primers 27F and 1492R (27F: AGAGTTTGATCCTGGCTCAT; 1492R: ACGGCTACCTTGTTACGACTT) were used to amplify the rDNA sequence of the Antarctic strain N31116S. The total DNA of N311 was used as the PCR amplification template, and the PCR reaction was carried out on a PCR amplification instrument. The reaction conditions were: denaturation at 94°C for 1 min; annealing at 55°C for 1 min; extension at 72°C for 1.5 min, 30 cycles. After the amplified sequence was sequenced by a sequencing company, the 16S rDNA sequence of the strain was obtained. The sequence was compared with the nucleic acid data in GenBank of the National Center for Biotechnology Information (http: / / ncbi.nlm.nih.gov / blast). The results showed that the 16S rDNA sequence of N311 had 99% sequence similarity with Bacillus methylotrophicus (HQ662596.1), Bacillus amyloliquefaciens (JF460737.1), and Bacillus amyloliqu...
Embodiment 3
[0029] Embodiment 3: the mensuration of phytopathogenic fungi antimicrobial spectrum
[0030] The inhibitory activity of Bacillus sp. N311 against 10 plant pathogenic fungi was determined by disc method. Use a sterile puncher to make the test pathogenic fungus into a bacterial block, pick a bacterial block with a toothpick and inoculate it in the center of the potato solid medium plate, and cultivate it under the condition of 28°C. After the mycelium of the pathogenic fungus to be tested spreads and grows, a sterilized double-layer filter paper sheet (diameter 6 mm) is placed around the bacterial block, and the filter paper sheet is about 1 cm away from the edge of the mycelium. Add 50 μL of sterile fermentation supernatant to each filter paper sheet, and continue to cultivate for 24 hours. By comparing with the control group, observe whether the growth of mycelium will be inhibited. If the mycelium of the tested pathogenic fungus is inhibited, the bacteria The filaments will...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



