Construction method of corynebacterium glutamicum engineering bacteria for high production of L-lysine

A technology of glutamic acid rods and construction methods, applied in the direction of microorganism-based methods, other methods of inserting foreign genetic materials, genetic engineering, etc., can solve the problem of low yield

Pending Publication Date: 2016-09-21
QILU UNIV OF TECH +2
View PDF6 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although natural microorganisms can directly ferment and produce L-lysine, the yield is usually low, so microorganisms need to be modified

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of corynebacterium glutamicum engineering bacteria for high production of L-lysine
  • Construction method of corynebacterium glutamicum engineering bacteria for high production of L-lysine
  • Construction method of corynebacterium glutamicum engineering bacteria for high production of L-lysine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Example 1: Construction of gene knockout fragments

[0058] 1) (i) extracting the genomic DNA of Corynebacterium glutamicum (Corynebacterium glutamicum) 23604, using the genomic DNA as a template, performing PCR amplification to obtain the homology arm NCg1;

[0059] Described PCR primer sequence is as follows:

[0060] F1:CG GGATCC CGTTTTTCATGCTTGCCGTCT;

[0061] R1: AAGGCCAGCAAAAGCTAAAGCCCAAGAATGCAAC;

[0062] Described PCR amplification system is:

[0063]

[0064]

[0065] The PCR amplification procedure is as follows:

[0066] Pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 30 sec, 30 cycles; extension at 72°C for 10 min, storage at 4°C;

[0067] The PCR product was checked by agarose gel electrophoresis, the length was 528bp, and the SanPrep column DNA gel recovery kit (Shanghai Sangong) was used for gel recovery, and the recovered product was stored at -20°C for later use;

[006...

Embodiment 2

[0086] Embodiment 2: preparation bacillus licheniformis competent

[0087] (i) Pick a single colony of Corynebacterium glutamicum (Corynebacterium glutamicum) 23604, inoculate it in 10 mL of seed medium, cultivate overnight at 37°C and 220 r / min;

[0088] Seed medium, the components are as follows:

[0089] Peptone 10g, yeast powder 5g, sodium chloride 10g, sorbitol 91g.

[0090] (ii) Take 1mL of the above bacterial solution and transfer it to 100mL seed medium, and cultivate it to OD at 37°C and 220r / min 600 =0.9;

[0091] (iii) Transfer the bacterial solution to a 100mL centrifuge tube, and place it in an ice bath for 15-20 minutes to stop the growth of the bacterial cells;

[0092] (iv) Centrifuge at 4°C, 5000g, 5min after ice bath, and collect the bacteria;

[0093] (v) The thalline after centrifugation is washed 3 times with pre-cooled electroporation buffer (ETM);

[0094] Electroporation buffer, the composition per liter is as follows:

[0095] Sorbitol 91g, Manni...

Embodiment 3

[0098] Example 3: NCg1-Cm r Fragment electrotransformation of Corynebacterium glutamicum 23604

[0099] (i) NCg1-Cm r The fragment was digested with restriction endonuclease BamH I at 30°C for 3 h; the digestion system (40 μL) was as follows:

[0100]

[0101] (ii) Concentrate and purify the digested product

[0102] (1) Add 1 / 10 volume of 3M sodium acetate and 2.5 volumes of absolute ethanol, and place in a -20°C refrigerator for 20 minutes;

[0103] (2) Centrifuge at 12000r / min for 5min to obtain a precipitate;

[0104] (3) 300 μL of 75% ethanol by volume to resuspend the pellet;

[0105] (4) Centrifuge at 12000r / min for 5min, remove ethanol, and air-dry at 37°C for 30min,

[0106] (5) Add 15-18μL ddH 2 O Resuspend DNA and store at -20°C.

[0107] (iii) Electroconversion

[0108] Firstly, NCg1-Cm was measured by nucleic acid ultramicro spectrophotometer r Fragment concentration, after reaching 300 μg / mL concentration, 2100V electric shock for 5ms, and electrotran...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a construction method of corynebacterium glutamicum engineering bacteria for high production of L-lysine. According to the method, the engineering bacteria are constructed by inactivating an NCgl1221 gene of corynebacterium glutamicum, wherein the nucleotide sequence of an NCgl1221 gene encoding frame is shown as SEQ ID NO. 1. The invention provides a construction method of a corynebacterium glutamicum strain for high production of the L-lysine; the constructed strain can obviously decrease glutamicum exocytosis due to the inactivation of the endogenous gene NCgl1221; compared with a wild strain, the strain can be used for producing high-concentration L-lysine and can effectively reduce the content of glutamicum which is a byproduct of a fermentation liquor; and the strain, as an L-lysine production strain, can further reduce production cost and purification cost.

Description

technical field [0001] The invention relates to a method for constructing a high-yield L-lysine Corynebacterium glutamicum engineering bacterium, belonging to the technical field of biotechnology. Background technique [0002] L-Lysine belongs to the aspartic acid family of amino acids and is one of the eight essential amino acids for humans and animals. L-lysine has a variety of physiological functions, such as balancing amino acid composition, regulating internal metabolic balance, improving the body's absorption and utilization of cereal protein, and promoting body growth and development, so it is widely used in feed, food and pharmaceutical industries. middle. Due to the strong market demand, L-lysine has become the second largest amino acid after glutamic acid, with an annual output of about 3.5 million tons. There are three main methods for industrial production of L-lysine, namely proteolysis, chemical synthesis and microbial fermentation. Among them, the microbial...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12P13/08C12N15/90C12R1/15
CPCC07K14/34C12N15/902C12P13/08C12R2001/15
Inventor王瑞明汪俊卿王蕾王腾飞李桂华王建彬隋松森
OwnerQILU UNIV OF TECH