Application of mycobacterium tuberculosisantigen protein Rv2351c
A technology of mycobacterium tuberculosis and rv2351c, which is applied in the fields of molecular biology and immunology, can solve the problems of low sensitivity, trauma to the body, and false positives, and achieve the effects of improving detection sensitivity, reducing false negatives, and strong immunogenicity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Example 1 Cloning of Mycobacterium tuberculosis antigen gene Rv2351c and protein expression and purification
[0044] 1. Primer design: According to the genome sequence of Mycobacterium tuberculosis H37Rv on NCBI, use the software Primer5 to design primers, upstream primer: GCGCGGATCCATGTCACGTCGAGAGTTTTTG (including BamH1 restriction site), downstream primer: ATATAAGCTTTCAGCTGCACAGCCCGCTGG (including HindⅢ restriction site).
[0045] 2. Amplification of the target gene: Utilize the CTAB method to extract the genomic DNA of Mycobacterium tuberculosis H37Rv, and use the DNA as a template to amplify the target gene. The PCR reaction system is as follows:
[0046]
[0047] PCR reaction program: hot start at 95°C for 5 min; denaturation at 94°C for 1 min, annealing at 60°C for 1 min, extension at 72°C for 1 min, 30 cycles; and finally incubation at 72°C for 10 min.
[0048] 3. Identification of the target gene: Take 7 μl of the PCR product for electrophoresis in 1% agaros...
Embodiment 2
[0095] Example 2 Preparation of Tuberculosis ELISPOT Detection Kit
[0096] The basic composition of the test kit is as follows:
[0097] ① The protein antigen Rv2351c prepared in Example 1.
[0098] ② Primary antibody: mouse IgG monoclonal antibody against human or animal IFN-γ.
[0099] Enzyme-labeled reagent: another mouse IgG monoclonal antibody labeled with horseradish peroxidase against different epitopes of human or animal IFN-γ.
[0100] ③Standard product:
[0101] Culture plate: 96-well microwell reaction plate containing PVDF membrane or nitrocellulose membrane, the positive control well contains tuberculosis non-specific stimulating antigen (such as PHA, etc.), and the local control contains PBS or basal solution.
[0102] ④ Other reagents and consumables required for ELISPOT detection.
[0103] The primary antibody was immobilized on the above-mentioned microwell reaction plate.
[0104] The kit is designed based on the principle of double-antibody sandwich. T...
Embodiment 3
[0105] Example 3 Antigen protein Rv2351c is used for clinical detection of tuberculosis infection
[0106] 1. Isolation of Peripheral Blood Lymphocytes
[0107] 1.1 Subjects
[0108] Screening criteria for volunteer cases:
[0109] Pulmonary tuberculosis patients diagnosed with clinical manifestations, symptoms, signs and chest imaging examinations, and with positive sputum culture.
[0110] Screening criteria for patients with pulmonary disease:
[0111] Other lung diseases with negative sputum culture and sputum smear, such as pneumoconiosis, chronic obstructive pulmonary disease and other lung diseases.
[0112] Screening criteria for healthy volunteers:
[0113] No clinical symptoms of tuberculosis, no history of close contact with tuberculosis patients, no other diseases or infections.
[0114] The enrolled TB patients and volunteers, aged 15-80, were randomly selected from a continuous-time sample of visits to the TB ward. A total of 60 tuberculosis volunteers, 33 ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More