Bacillus subtilis engineering bacteria and application thereof

A technology of Bacillus subtilis and engineering bacteria, applied in the field of bioengineering, can solve the problems of large contamination risk and poor tolerance

Pending Publication Date: 2017-02-15
SHANDONG FOOD & FERMENT IND RES & DESIGN INST
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] In view of the above-mentioned problems existing in the prior art, especially in view of the problem that the found strain SFR-4 has poor environmental tolerance and a large risk of bacterial infection in the production process, the present invention provides a strain with strong stress resistance and non-infection Bacillus subtilis engineering bacteria for D-ribose fermentation of bacteria. The present invention is based on the problem of poor stress resistance of transketolase-deficient D-ribose high-yielding Bacillus subtilis obtained by traditional mutation breeding, and obtains a strain by means of molecular biology. A high-yielding D-ribose strain with the characteristics of good stress resistance and fast sugar consumption

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus subtilis engineering bacteria and application thereof
  • Bacillus subtilis engineering bacteria and application thereof
  • Bacillus subtilis engineering bacteria and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0072] Example 1 strain SFR-43T construction

[0073] (1) Using the strain SFR-4 genome as a template, amplify the 500 bp fragment (including the mutation site) before the stop codon of the transketolase gene of the strain, called L-tkt (its sequence is shown in SEQ ID NO.10) . Its downstream primer contains the front 25bp complementary sequence of lox71-zeo-lox66.

[0074] Template: strain SFR-4 genome

[0075] Upstream primer: GCAGCATGGAAGCTTGCAG (SEQ ID NO.1)

[0076] Downstream primer: TATAATGTATGCTATACGAACGGTATTATCTTGATACTATATAGAAACATCTCAAGG (SEQ ID NO.2)

[0077] PCR reaction system (50uL): strain SFR-4 genomic DNA template 1uL, upstream primer 1uL, downstream primer 1uL, 2*Buffer 25uL, dNTP 4uL, high-fidelity PCR enzyme PrimeSTAR 0.5uL, sterile water 17.5uL.

[0078]PCR reaction conditions: denaturation at 95°C for 5min, 10s at 98°C, 30s at 60.3°C, 30s at 72°C, 33 cycles.

[0079] The amplified products were detected and collected by 1% agarose gel electrophoresis....

Embodiment 2

[0110] Embodiment 2 bacterial strain SFR-43T product analysis

[0111] Take the fresh slant of the strain SFR-43T cultured at 37°C for 2 days, use an inoculation loop to take 1-2 rings of the slant strain, inoculate it into the liquid seed medium, cultivate it on a shaker at 37°C for 14 hours at 180rpm, and inoculate and ferment with 5% inoculum Medium, 37°C, 180rpm shake flask culture for 72 hours. The fermentation broth was centrifuged at 4500rpm for 10min, and the supernatant was taken for product analysis. The results showed that 3-hydroxybutanone and D-ribose components were detected simultaneously in the fermentation broth of the strain SFR-43T.

[0112] Fermentation medium (g / L): glucose 150g / L, yeast extract 5g / L, corn steep liquor 10g / L, (NH 4 ) 2 SO 4 2.5g / L, MgSO 4 2g / L, MnSO 4 0.2g / L, pH6.5.

Embodiment 3

[0113] Embodiment 3 fermentation medium optimization

[0114] Based on the strain SFR-4D-ribose fermentation medium, the present invention further optimizes the nitrogen source and other components of the culture medium for the fermentation of D-ribose by the strain SFR-43T.

[0115] Nitrogen source optimization: take fresh slant of the strain SFR-43T cultivated at 37°C for 2 days, pick 1-2 rings with an inoculation loop, inoculate into liquid seed medium, culture at 37°C, 180rpm shaker for 14 hours, inoculum volume 5% , inoculated into shake flask fermentation media containing different nitrogen sources (the nitrogen sources were respectively peptone, yeast extract, corn steep liquor dry powder, ammonium nitrate, diammonium hydrogen phosphate, ammonium sulfate, the concentration was 10g / L, and the carbon source was Glucose, the other components are the same), 37 ° C, 180 rpm shake flask culture for 72 hours. The fermentation broth was centrifuged to remove bacteria, and the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses bacillus subtilis engineering bacteria and application thereof. Whole genome sequencing comparative analysis shows that SFA-H43 and a D-ribose high-producing strain SFR-4 are higher in homology, and the nucleotide sequences of transketolase gene sequences except mutation sites are totally the same. According to the bacillus subtilis engineering bacteria disclosed by the invention, by adopting the way of homologous recombination, a transketolase gene mutation sequence of an SFR-4 strain is shifted into an SFA-43 strain so as to replace a normal sequence of transketolase genes of the SFA-43 strain, so that a transketolase mutant engineering strain SFR-43T is obtained; the transketolase mutant engineering strain SFR-43T not only maintains good fermentation properties (good stress resistance, fast glucose consumption speed, vigorous growth and difficulty in bacterial infection) of the SFA-43 strain, but also is capable of accumulating D-ribose, and the fermentation stress resistance is obviously increased.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, relates to the breeding of industrial microorganisms and the microbial fermentation preparation of industrial products, in particular to a Bacillus subtilis engineering bacterium and its application. Background technique [0002] D-ribose is a five-carbon sugar, which is an important part of life genetic material ribonucleic acid and physiologically active substances ATP, NADH, NADPH, and FADH. It is a major participant in energy metabolism in organisms and has important physiological functions. [0003] D-ribose is mainly used in industry for riboflavin vitamin B 2 As well as the production of food flavoring agents, in recent years, more studies have used D-ribose as a pharmaceutical intermediate for the synthesis of antiviral and anti-tumor drugs. In addition, D-ribose can also be used as an auxiliary drug for the treatment of Myocardial ischemia, muscle stiffness caused by overuse, mus...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12P19/02C12P7/26C12R1/125
CPCC12N9/1022C12P7/26C12P19/02C12Y202/01001
Inventor赵祥颖赵晨刘建军田延军张俊娇张家祥张立鹤
OwnerSHANDONG FOOD & FERMENT IND RES & DESIGN INST