Acyl coenzyme A-reductase gene phsR and application thereof

A reductase and coenzyme technology, applied in the direction of oxidoreductase, application, genetic engineering, etc., to achieve the effect of improving utilization rate, simplifying preparation process, reducing production raw material cost and energy consumption

Active Publication Date: 2017-02-22
ZHEJIANG XIANJU PHARMA
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In view of the above problems and deficiencies in the prior art, the present invention aims to provide an acyl-CoA-reductase gene phsR and its application to solve the problem of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Acyl coenzyme A-reductase gene phsR and application thereof
  • Acyl coenzyme A-reductase gene phsR and application thereof
  • Acyl coenzyme A-reductase gene phsR and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: Acquisition, molecular identification and heterologous expression recombinant plasmid of M.neoaurum acyl-CoA-reductase phsR gene and construction of Escherichia coli recombinant bacteria

[0027] This example only takes the PCR method as an example. By analyzing and comparing the whole genome information of Mycobacterium aureus VKM Ac-1815D, the complete acyl-CoA-reductase phsR gene is obtained, and the PCR amplification product is designed. The DNA sequence of phsR cloned from M. neoaurum is shown in SEQ ID NO.1, and the corresponding amino acid sequence is shown in SEQ ID NO.2.

[0028] Through the software-related bioinformatics analysis software Vector NTI, BioEdit and the bioinformatics website, the corresponding conserved sequences and structures of the relevant coenzyme A-reductases in Mycobacterium aureus were searched and compared, and the phsR in the genome of VKMAc-1815D was obtained. The position and related sequence information in the phsR were a...

Embodiment 2

[0036] Example 2: Construction of engineering strains for deletion of phsR gene

[0037] Construct the phsR gene knockout plasmid in Mycobacterium aureus, denature the plasmid accordingly, and transform it into competent cells of Mycobacterium aureus through electrotransformation. The recombinants of the first round of recombination were serially passaged and then screened on a sucrose plate for the second round of recombination, and then the recombinants were verified by PCR after corresponding resistance verification.

[0038] The specific implementation steps are as follows:

[0039] 1) Obtaining the sequence of the upstream and downstream homology arms of the phsR gene and constructing the recombinant plasmid:

[0040] For the new Mycobacterium aureus phsR gene sequence, the upstream and downstream homology arms of the gene knockout primers were designed, as shown in the following sequence:

[0041] phsR-L-F:CG GAATTC TGGGGACTTTGTCTTCGATCCAGGCTC

[0042] phsR-L-R:GC ...

Embodiment 3

[0051] Example 3: Application of engineering strains with phsR gene deletion in the preparation of AD by degradation of phytosterols

[0052] Use surfactants or organic solvents to aid the dissolution of sterols, and adopt secondary seed culture; transfer the transformation medium containing sterols with an inoculum size of 5-30wt%, and the sterol dosage is 5-40g / L, 28-37 ℃, under the condition of high dissolved oxygen for 6-8 days; after the conversion, the conversion solution was extracted twice with twice the volume of ethyl acetate, and the combined extracts were spin-dried and redissolved in methanol or acetonitrile for HPLC analysis.

[0053] In this example, 1% Tween80 is used to solubilize sterols, and secondary seed culture is used; the liquid volume of the transformation medium is 50mL / 250mL, the inoculum size is 10wt%, 30°C, 200rpm, and the transformation is 6d; through a C18 reverse-phase column The prepared fermentation product is carried out to HPLC detection ana...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an acyl coenzyme A-reductase gene phsR and the application thereof. The acyl coenzyme A-reductase gene phsR has a nucleotide sequence shown as SEQ ID No. 1. The invention also provides an engineering strain with deletion of the acyl coenzyme A-reductase gene phsR. The engineering strain is named as Mycobacterium neoaurum Delta phsR, and has a collection number of CCTCC NO. M2016321. The engineering strain disclosed by the invention is capable of effectively eliminating 4-BNA by-products in the sterol degradation process, obviously improving the purity and the yield of AD, ADD, 9-OH-AD and other series of steroid products prepared by depending on the sterol degradation, reducing the cost of raw materials for producing steroid drugs and the energy consumption, improving the utilization rate of prodrugs and greatly simplifying the preparation process of AD and other steroid drugs, and has a high industrial application value.

Description

technical field [0001] The invention relates to an acyl coenzyme A-reductase gene phsR and its application, belonging to the field of biotechnology. Background technique [0002] Steroidal drugs, also known as steroids, play an important role in clinical practice. According to their function, steroid drugs can be roughly divided into sex hormones, corticosteroids and anabolic hormones. At present, the average annual sales of steroid drugs in the global market is more than 40 billion US dollars, accounting for about 10% of the world's total pharmaceutical products (Appl Microbiol Biotechnol, 2012, 94, 1423-1447). Among them, androst-4-ene-3,17-dione (androst-4-end-3,17-dione, AD) is the core intermediate of steroid raw materials, and almost all steroid hormone drugs can be listed as AD For the production of starting materials, such as: for the production of corticosteroids, sex hormones, progesterone and anabolic hormones, and for the synthesis of more than 100 kinds of dru...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/53C12N1/21C12P33/02C12R1/32
CPCC12N9/0004C12P33/02
Inventor 瞿旭东刘学胜罗煜丁时诚
Owner ZHEJIANG XIANJU PHARMA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap