Metabolism detection kit for compound medicine for rhinitis in child
A detection kit and the technology of the kit are applied in the field of metabolic detection kits for compound drugs, which can solve the problems of unfavorable real-time monitoring, high instrument requirements, complicated detection, etc., and achieve the effects of reduced detection cost, high sensitivity and simple preparation.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0016] Example 1 Screening of Neo-synephrine aptamers
[0017] Artificially synthesize single-stranded DNA sequences, and construct single-stranded DNA random sequence oligonucleotide libraries. The DNA sequences included in the single-stranded DNA random oligonucleotide libraries are:
[0018] 5'-TTGCAGGGAACATTCAGACT-N36-CGTTACTCGTGGTCATGTCC-3'
[0019] The DNA sequence of the single-stranded DNA random oligonucleotide library includes a random sequence N36 in the middle and a fixed sequence at both ends, the random sequence N36 in the middle is a random sequence of 36 bases, and the fixed sequence at both ends is: TTGCAGGGAACATTCAGACT, CGTTACTCGTGGTCATGTCC, the fixed sequence at both ends is the PCR amplification primer binding region;
[0020] (2) Preparation of phenylephrine hydrochloride-micromagnetic bead complex: 0.75ml of micromagnetic beads with activated amino groups and 10mg of phenylephrine hydrochloride in coupling buffer (15mM potassium phosphate buffer, 0.20M N...
Embodiment 2
[0024] The mensuration of embodiment 2 dissociation constant
[0025] Take 1.5 μg of the aptamers, digest them with calf intestinal alkaline phosphatase (CIP) at 37°C for 1 h, purify and recover the dephosphorylated aptamers; label [γ-32P]ATP with T4 polynucleotide kinase to dephosphorylate The ends of the normalized aptamer molecules. 10nmol of radioactively labeled aptamers were incubated with different concentrations (1-200nM) of phenylephrine hydrochloride at 37°C for 30min, the reaction solution of each group was filtered through nitrocellulose membrane, the filter membrane was washed, dried, and liquid scintillation counting The radioactivity remaining on the filter membrane was measured by the instrument, and the same sample was measured twice in parallel. The dissociation constants of each aptamer with phenylephrine hydrochloride were calculated. The result is as follows:
[0026] name Dissociation constant Kd(nM) Neo-synephrine-1 32.5 Neo-syne...
Embodiment 3
[0028] Example 3 Construction of Aptamer Electrochemical Biosensor
[0029] (1) Polishing and activation treatment of bare gold electrode surface
[0030]Grind the bare gold electrode with 0.3 μm alumina powder for 10 minutes, then polish it with 0.05 μm alumina powder for 20 minutes, and then ultrasonically clean it twice with ultrapure water for 5 minutes each time to completely remove the non-specific adsorption on the bare gold electrode. Aluminum oxide powder on the electrode surface. Immerse the cleaned bare gold electrode in freshly prepared hot Piranha solution (concentrated sulfuric acid: 30% H2O2 = 7:3, V:V) and activate it at room temperature for 10 minutes to obtain an activated bare gold electrode. Then ultrasonic cleaning was performed twice with ultrapure water and absolute ethanol, 5 minutes each time.
[0031] (2) Modification of aptamer electrochemical sensors
[0032] Take 2 μL of phenylephrine hydrochloride aptamer solution with a concentration of 100 μm...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

