Unlock instant, AI-driven research and patent intelligence for your innovation.

Metabolism detection kit for compound medicine for rhinitis in child

A detection kit and the technology of the kit are applied in the field of metabolic detection kits for compound drugs, which can solve the problems of unfavorable real-time monitoring, high instrument requirements, complicated detection, etc., and achieve the effects of reduced detection cost, high sensitivity and simple preparation.

Inactive Publication Date: 2017-05-31
戴伟利
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

(4) Other treatments include block therapy, acupuncture therapy, etc., which are rarely used
In the prior art, liquid chromatography is generally used for detection, but this detection has relatively high requirements for instruments, and the detection complexity is not conducive to real-time monitoring

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Metabolism detection kit for compound medicine for rhinitis in child
  • Metabolism detection kit for compound medicine for rhinitis in child

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] Example 1 Screening of Neo-synephrine aptamers

[0017] Artificially synthesize single-stranded DNA sequences, and construct single-stranded DNA random sequence oligonucleotide libraries. The DNA sequences included in the single-stranded DNA random oligonucleotide libraries are:

[0018] 5'-TTGCAGGGAACATTCAGACT-N36-CGTTACTCGTGGTCATGTCC-3'

[0019] The DNA sequence of the single-stranded DNA random oligonucleotide library includes a random sequence N36 in the middle and a fixed sequence at both ends, the random sequence N36 in the middle is a random sequence of 36 bases, and the fixed sequence at both ends is: TTGCAGGGAACATTCAGACT, CGTTACTCGTGGTCATGTCC, the fixed sequence at both ends is the PCR amplification primer binding region;

[0020] (2) Preparation of phenylephrine hydrochloride-micromagnetic bead complex: 0.75ml of micromagnetic beads with activated amino groups and 10mg of phenylephrine hydrochloride in coupling buffer (15mM potassium phosphate buffer, 0.20M N...

Embodiment 2

[0024] The mensuration of embodiment 2 dissociation constant

[0025] Take 1.5 μg of the aptamers, digest them with calf intestinal alkaline phosphatase (CIP) at 37°C for 1 h, purify and recover the dephosphorylated aptamers; label [γ-32P]ATP with T4 polynucleotide kinase to dephosphorylate The ends of the normalized aptamer molecules. 10nmol of radioactively labeled aptamers were incubated with different concentrations (1-200nM) of phenylephrine hydrochloride at 37°C for 30min, the reaction solution of each group was filtered through nitrocellulose membrane, the filter membrane was washed, dried, and liquid scintillation counting The radioactivity remaining on the filter membrane was measured by the instrument, and the same sample was measured twice in parallel. The dissociation constants of each aptamer with phenylephrine hydrochloride were calculated. The result is as follows:

[0026] name Dissociation constant Kd(nM) Neo-synephrine-1 32.5 Neo-syne...

Embodiment 3

[0028] Example 3 Construction of Aptamer Electrochemical Biosensor

[0029] (1) Polishing and activation treatment of bare gold electrode surface

[0030]Grind the bare gold electrode with 0.3 μm alumina powder for 10 minutes, then polish it with 0.05 μm alumina powder for 20 minutes, and then ultrasonically clean it twice with ultrapure water for 5 minutes each time to completely remove the non-specific adsorption on the bare gold electrode. Aluminum oxide powder on the electrode surface. Immerse the cleaned bare gold electrode in freshly prepared hot Piranha solution (concentrated sulfuric acid: 30% H2O2 = 7:3, V:V) and activate it at room temperature for 10 minutes to obtain an activated bare gold electrode. Then ultrasonic cleaning was performed twice with ultrapure water and absolute ethanol, 5 minutes each time.

[0031] (2) Modification of aptamer electrochemical sensors

[0032] Take 2 μL of phenylephrine hydrochloride aptamer solution with a concentration of 100 μm...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a metabolism detection kit for a compound medicine for rhinitis in a child and belongs to the field of biological detection. The kit comprises an aptamer capable of being specifically combined with phenylephrine hydrochloride. The kit can accurately identify the accumulated amount of phenylephrine hydrochloride in the child, so that damage on two ways caused by excessive amount is avoided, and meanwhile, a basis is also provided for guiding pharmacy. The detection method is low in cost, convenient to operate and convenient to popularize and has a good application prospect.

Description

technical field [0001] The invention belongs to the field of gene detection, and relates to a metabolic detection kit of a compound drug for rhinitis in children. Background technique [0002] Rhinitis is an inflammatory disease of the nasal cavity, which is the inflammation of the nasal mucosa caused by viruses, bacteria, allergens, various physical and chemical factors, and certain systemic diseases. The main pathological changes of rhinitis are congestion, swelling, exudation, hyperplasia, atrophy or necrosis of nasal mucosa. The main causes are as follows: viral infection is the primary cause, or bacterial infection is secondary to viral infection. There are more than 100 kinds of viruses known to cause this disease, the most common being rhinovirus, followed by influenza and parainfluenza virus, adenovirus, coronavirus, Coxsackie virus and myxovirus and paramyxovirus. The main mode of virus transmission is inhalation through the respiratory tract, followed by entering...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N27/327G01N27/26G01N33/74G01N33/543
CPCG01N27/26G01N27/327G01N33/54326G01N33/74G01N2446/90G01N2800/14
Inventor 戴伟利
Owner 戴伟利