Escherichia coli for expressing hydroxytyrosol and hydroxytyrosol glucoside and construction method and application thereof

A technology of hydroxytyrosol and Escherichia coli, which is applied in the field of bioengineering, can solve the problems of low yield and yield of glycosylated strains, unsafety, complicated process, etc., and achieves easy large-scale fermentation culture, low cost, and rapid growth Effect

Active Publication Date: 2017-09-26
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF3 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In 2009, Seeberger and others studied the chemical method of glycosylation, but this method is greatly affected by the environment, and the production efficiency is low (Seeberger PH, FinneyN, Rabuka D, Bertozzi CR.2009.Chemical and Enzymatic Synthesis of Glycans and Glycoconjugates. ); in 2006, Mao et al. carried out glycosylation reaction by biotransformation in microorganisms, but the yield and yield of glycosylated strains were generally low (Mao Z, Shin HD, Chen RR.2006.Engineering the E. coliUDP-glucose synthesis pathway for oligosaccharide synthesis.Biotechnol Prog 22(2):369–374.); In 2015, Frederik De Bruyn et al introduced the sucrose metabolism pathway in recombinant E. coli and under the action of glycosyltransferase UvGT2 , successfully obtained gallic acid glycosylation product gallic acid glucopyranose (Frederik De Bruyn, BrechtDe Paepe, Jo Maertens, Joeri Beaupreze. Development of an In Vivo Glucosylation Platform by Coupling Production to Growth: Production of Phenolic Glu

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Escherichia coli for expressing hydroxytyrosol and hydroxytyrosol glucoside and construction method and application thereof
  • Escherichia coli for expressing hydroxytyrosol and hydroxytyrosol glucoside and construction method and application thereof
  • Escherichia coli for expressing hydroxytyrosol and hydroxytyrosol glucoside and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Gene UGT73B6 or its mutant UGT73B6 FS For the specific acquisition method, please refer to Chinese patent 201510160497.8.

[0037] pET28a-UGT73B6 FS -P Trc ARO10-P Trc HpaBC construction method:

[0038] NotI and XhoI double restriction plasmid pTrcHisB-P Trc ARO10-P Trc HpaBC, obtained with P Trc Promoter Gene Fragment P Trc ARO10-P Trc HpaBC, and NotI and XhoI double-digested vector pET28a-UGT73B6 FS The fragments were ligated and transformed into E.coli DH5α to obtain the intermediate plasmid pET28a-UGT73B6 FS -P Trc ARO10-P Trc HpaBC.

[0039] Among them, pTrcHisB-P Trc ARO10-P Trc The construction method of HpaBC is consistent with that in Chinese patent 201510242626.8 (a method and application of Escherichia coli to produce hydroxytyrosol using a simple carbon source such as glucose); pET28a-UGT73B6 FS The construction method of pET28a-UGT73B6 is consistent with the literature construction method of pET28a-UGT73B6 (Bai Y, Bi H, Zhuang Y, et al. Prod...

Embodiment 2

[0041] Construction method of plasmid pBb0-T7:

[0042] Using Escherichia coli BL21 (DE3) genomic DNA as a template, using primers T7Pol-5FPEcoRI (SEQ ID No: 1) / T7Pol-3RPPstI (SEQ ID No: 2) to amplify the T7 polymerase gene fragment, EcoRI and PstI double enzyme T7 polymerization The enzyme gene fragment and the expression vector pBb0 were transformed into E. coli DH5α to obtain the vector pBb0-T7. Among them, the construction method of pBb0 is consistent with the literature (Bai Y, Bi H, Zhuang Y, et al. Production of salidroside in metabolically engineered Escherichia coli [J]. Scientific reports, 2014, 4: 6640-6647.).

[0043] SEQ ID No: 1 Sequence: CCGGAATTCATGAACACGATTAACATCGCTAAG

[0044] SEQ ID No: 2 Sequence: GTTCTGCAGTTACGCGAACGCGAAGTCCGACTC

[0045] In the above steps, the reaction program of the PCR amplification reaction can be a conventional PCR amplification reaction program, for example, it can be: 94-95°C pre-denaturation for 4-5 minutes; 96-98°C denaturation...

Embodiment 3

[0047] Plasmid pET28a-UGT73B6 FS -P Trc ARO10-P Trc HpaBC-P lacUV5 The construction method of T7:

[0048] Using pBb0-T7 as a template, PCR amplification with P lacUV5 Promoter of the T7 polymerase gene. The PCR primers are T7-5FP-XhoI, whose sequence is shown in SEQ ID No: 3, and T7-3RP-XhoI, whose sequence is shown in SEQ ID No: 4. Use XhoI to single-enzyme digest with P lacUV5 Promoter of T7 polymerase gene and vector pET28a-UGT73B6 FS -P Trc ARO10-P Trc HpaBC, and transformed into E.coli DH5α, the final expression vector pET28a-UGT73B6 was obtained FS -P Trc ARO10-P Trc HpaBC-P lacUV5 T7.

[0049] SEQ ID No: 3 Sequence: CCGCTCGAGTTTACACTTTATGCTTCCG

[0050] SEQ ID No: 4 Sequence: CCGCTCGAGTTACGCGAACGCGAAGTCC

[0051] In the above steps, the reaction procedure of the PCR amplification reaction is the same as in Example 2.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses Escherichia coli for expressing hydroxytyrosol and hydroxytyrosol glucoside and a construction method and application thereof; the Escherichia coli for expressing hydroxytyrosol and hydroxytyrosol glucoside contains and can express ARO10, HpaBC and UGT genes. Tyrosine pathway related genes of the recombinant Escherichia coli are overexpressed so that the yields of hydroxytyrosol, hydroxytyrosol-3-O-beta-D-glucoside and hydroxytyrosol-4-O-beta-D-glucoside can be increased significantly, wherein the yield of hydroxytyrosol may reach 401 mg/L, the yield of hydroxytyrosol-3-O-beta-D-glucoside may reach 406 mg/L, the yield of hydroxytyrosol-4-O-beta-D-glucoside may reach 928 mg/L, and basis is laid for the large-scale industrial production and application of the Escherichia coli.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to an Escherichia coli expressing hydroxytyrosol and hydroxytyrosol glucoside, a construction method and application thereof. Background technique [0002] Hydroxytyrosol, Chinese alias: 3,4-dihydroxyphenethyl alcohol. Molecular formula: C 8 h 10 o 3 . Structural formula: Molecular weight: 154.1632. Hydroxytyrosol-3-O-β-D-glucoside (Hydroxytyrosol-3-O-β-D-glycoside), molecular formula: C 14 h 20 o 8 , the structural formula: Molecular weight: 316.31. Hydroxytyrosol-4-O-β-D-glucoside (Hydroxytyrosol-4-O-β-D-glycoside), molecular formula: C 14 h 20 o 8 , the structural formula: Molecular weight: 316.31. [0003] Hydroxytyrosol is a natural polyphenol compound with fat solubility, water solubility and biological activity. It mainly exists in various parts of olives in the form of esterified oleuropein. After hydrolysis, oleuropein can be obtained as...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N1/21C12N15/70C12N15/60C12N15/53C12N15/54C12P7/22C12P19/44C12R1/19
CPCC12N9/0004C12N9/10C12N9/88C12P7/22C12P19/44
Inventor 刘涛殷华庄以彬李晓林毕慧萍马延和
Owner TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap