Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of valeriana jatamansi jones extract in preparing HSP70 activating drug

A spider incense and extract technology, applied in the field of biomedicine, can solve problems such as many side effects, high toxicity, and many targets

Inactive Publication Date: 2017-12-29
LANZHOU UNIVERSITY
View PDF6 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, some activators of HSP70 have been found, such as teprenone for the treatment of gastric ulcer, protease inhibitors for neurodegenerative diseases, stannous chloride for tissue metastasis, etc., but these activators The toxic side effects of traditional Chinese medicine are relatively large, and the side effects are many, while the toxic and side effects of traditional Chinese medicine are relatively small, and there are many targets, so screening the activators that can significantly activate HSP70 from the traditional Chinese medicine database will be of great benefit to the treatment or prevention of diseases related to HSP70

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of valeriana jatamansi jones extract in preparing HSP70 activating drug
  • Application of valeriana jatamansi jones extract in preparing HSP70 activating drug
  • Application of valeriana jatamansi jones extract in preparing HSP70 activating drug

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 Establishment of Screening Cell Model Based on HSPA1A Promter

[0037] 1. Cloning of HSPA1A Promoter gene

[0038] (1) Design and synthesis of HSPA1A Promoter PCR primers

[0039] P1: CCCAAGCTTCGGATCAGCCAACGCCCATACCTC

[0040] P2: CGCGGATCCCGGTTCCCTGCTCTCTGTCGGCTCC

[0041] (2) PCR amplification

[0042] Human blood was collected, and DNA was extracted according to the instructions of the blood genomic DNA extraction kit. Human DNA was used as a template, and P1 and P2 were used as upstream and downstream primers respectively for PCR amplification. The PCR system (25μL) is as follows:

[0043] Table 1 PCR reaction system

[0044]

[0045]

[0046] PCR reaction conditions: 98°C: 10s; 60°C: 15s; 68°C: 1min; 40 cycles. The PCR product was subjected to 1% agarose gel electrophoresis, and the result showed that a HSPA1A Promoter DNA band with a size of about 1000 bp was amplified.

[0047] (3) TA clone of HSPA1A Promoter

[0048] Add "A" to the PCR pr...

Embodiment 2

[0078] Example 2 Verification of screening cell models based on HSPA1A Promter

[0079] 1. The effect of heat shock on HSPA1A Promter

[0080] After 6 hours of transfection, 96-well plates were plated, and after 12 hours of culture, heat shock treatment was performed. The specific operation was as follows: cells in 3 wells were taken as the heat shock treatment group, and blank control wells were set at the same time. After aspirating the supernatant, wash the cells once with PBS, add 20 μL of trypsin to digest for 1 minute, add 200 μL of complete culture solution, transfer to a 1.5 mL EP tube, place on a metal bath at 41 ° C for 1 hour of heat shock treatment, Then transfer to a 96-well plate, put it in a cell culture incubator and continue culturing for 24 hours, observe and take pictures of green fluorescence and red fluorescence with an inverted fluorescence microscope, or use a Dual- Luciferase Assay System detects luciferase activity. Result: if figure 1 As shown, 41...

Embodiment 3

[0085] The effect of embodiment 3 spider perfume decoction on HSPA1A Promter

[0086] 1. Preparation of Spider Perfume Decoction

[0087] Weigh 25g of spider incense medicinal material, add 200mL distilled water to soak for 30 minutes; boil with strong fire and then cook with slow fire for 30 minutes; filter the filtrate with gauze, add 150mL distilled water to the filter residue and soak for 30 minutes; boil with strong fire and then cook with slow fire for 30 minutes; filter with gauze Combine the two filtrates, simmer and concentrate to about 25mL; centrifuge at 1000rpm for 10 minutes after natural cooling, filter with filter paper to remove impurities, and use a 25mL volumetric flask to constant volume to prepare 1g / mL spider perfume decoction stock solution, dilute before use to the desired concentration.

[0088] 2. MTT method to determine the effective drug action concentration range of spider perfume decoction

[0089] The day before the drug treatment, the 96-well p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a novel application of a valeriana jatamansi jones extract and in particular relates to an application of a valeriana jatamansi jones extract in preparing an HSP70 promoter drug and belongs to the field of biomedicines. The valeriana jatamansi jones extract is a valeriana jatamansi jones water decoction. By acting the valeriana jatamansi jones water decoction on a constructed HSP70 promoter cell screening model, the valeriana jatamansi jones water decoction can activate the HSP70 promoter, can be applied to preparing an activator or a drug for activating the HSP70 promoter, and has the potential of treating neurodegenerative diseases.

Description

technical field [0001] The invention belongs to the field of biomedicine, and specifically relates to the application of a traditional Chinese medicine extract in the preparation of an HSP70 promoter activator and the application in the preparation of a drug for activating the HSP70 promoter. Background technique [0002] Heat shock protein (HSP) is a type of heat stress protein that widely exists in prokaryotic cells and eukaryotic cells and is very conservative in evolution. It is divided into HSP90 (83-90KD) and HSP70 (66-78KD) according to the molecular weight 4 families, HSP60 and small HSP, among which HSP70 is the most conserved and important family in the heat shock protein family, and it is also the most concerned and studied one (Kiang and Tsokos, 1998). The human HSP70 family contains at least eight gene expression product proteins, namely HSP70-1a, HSP70-1b, HSP70-1t, HSP70-2, HSP70-5, HSP70-6, HSC70, and HSP70-9, which are all HSP70 genes with different The pro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K36/84A61P9/00A61P25/28A61P25/16A61P25/02A61P21/00
CPCA61K36/84A61K2236/331A61K2236/39A61K2236/53
Inventor 李红玉王亚军裴月娟朱红梅李洋支德娟余兰蒋云龙
Owner LANZHOU UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com