Application of valeriana jatamansi jones extract in preparing HSP70 activating drug
A spider incense and extract technology, applied in the field of biomedicine, can solve problems such as many side effects, high toxicity, and many targets
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1 Establishment of Screening Cell Model Based on HSPA1A Promter
[0037] 1. Cloning of HSPA1A Promoter gene
[0038] (1) Design and synthesis of HSPA1A Promoter PCR primers
[0039] P1: CCCAAGCTTCGGATCAGCCAACGCCCATACCTC
[0040] P2: CGCGGATCCCGGTTCCCTGCTCTCTGTCGGCTCC
[0041] (2) PCR amplification
[0042] Human blood was collected, and DNA was extracted according to the instructions of the blood genomic DNA extraction kit. Human DNA was used as a template, and P1 and P2 were used as upstream and downstream primers respectively for PCR amplification. The PCR system (25μL) is as follows:
[0043] Table 1 PCR reaction system
[0044]
[0045]
[0046] PCR reaction conditions: 98°C: 10s; 60°C: 15s; 68°C: 1min; 40 cycles. The PCR product was subjected to 1% agarose gel electrophoresis, and the result showed that a HSPA1A Promoter DNA band with a size of about 1000 bp was amplified.
[0047] (3) TA clone of HSPA1A Promoter
[0048] Add "A" to the PCR pr...
Embodiment 2
[0078] Example 2 Verification of screening cell models based on HSPA1A Promter
[0079] 1. The effect of heat shock on HSPA1A Promter
[0080] After 6 hours of transfection, 96-well plates were plated, and after 12 hours of culture, heat shock treatment was performed. The specific operation was as follows: cells in 3 wells were taken as the heat shock treatment group, and blank control wells were set at the same time. After aspirating the supernatant, wash the cells once with PBS, add 20 μL of trypsin to digest for 1 minute, add 200 μL of complete culture solution, transfer to a 1.5 mL EP tube, place on a metal bath at 41 ° C for 1 hour of heat shock treatment, Then transfer to a 96-well plate, put it in a cell culture incubator and continue culturing for 24 hours, observe and take pictures of green fluorescence and red fluorescence with an inverted fluorescence microscope, or use a Dual- Luciferase Assay System detects luciferase activity. Result: if figure 1 As shown, 41...
Embodiment 3
[0085] The effect of embodiment 3 spider perfume decoction on HSPA1A Promter
[0086] 1. Preparation of Spider Perfume Decoction
[0087] Weigh 25g of spider incense medicinal material, add 200mL distilled water to soak for 30 minutes; boil with strong fire and then cook with slow fire for 30 minutes; filter the filtrate with gauze, add 150mL distilled water to the filter residue and soak for 30 minutes; boil with strong fire and then cook with slow fire for 30 minutes; filter with gauze Combine the two filtrates, simmer and concentrate to about 25mL; centrifuge at 1000rpm for 10 minutes after natural cooling, filter with filter paper to remove impurities, and use a 25mL volumetric flask to constant volume to prepare 1g / mL spider perfume decoction stock solution, dilute before use to the desired concentration.
[0088] 2. MTT method to determine the effective drug action concentration range of spider perfume decoction
[0089] The day before the drug treatment, the 96-well p...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



