Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application of betula platyphylla suk. bHLH9 protein in regulation of synthesis of triterpenoids

A technology of triterpenoids and compounds, applied in the application field of birch bHLH9 protein in regulating the synthesis of triterpenoids, can solve the problem of under-understanding and excavation, complex secondary metabolic pathways, limited understanding of anabolic mechanisms and regulatory networks And other issues

Active Publication Date: 2018-01-26
NORTHEAST FORESTRY UNIVERSITY
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, secondary metabolic pathways are complex and there are complex interactions between different pathways
At present, except for the flavonoid pathway, the understanding of the anabolic mechanism and regulatory network of most secondary metabolic pathways is still limited, and the potential of increasing plant natural product content through metabolic genetic engineering has not yet been fully understood and tapped

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of betula platyphylla suk. bHLH9 protein in regulation of synthesis of triterpenoids
  • Application of betula platyphylla suk. bHLH9 protein in regulation of synthesis of triterpenoids
  • Application of betula platyphylla suk. bHLH9 protein in regulation of synthesis of triterpenoids

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Example 1, BpbHLH9 cDNA full-length cloning and bioinformatics analysis

[0071] 1. Obtaining the full length of the BpbHLH9 gene

[0072] Specific primers were designed according to the two ends of the known sequence of bHLH9 gene in the birch transcriptome database, and the reverse transcription product of birch total RNA was used as a template, and bHLH9-F / R was used as primers for PCR amplification to obtain PCR products. The primer sequences are as follows:

[0073] bHLH9-F: GGTGCCTCTCTTCTCGTGTT;

[0074] bHLH9-R: GCGGTAGATATGTCTCCTTCTG.

[0075] The resulting PCR product was subjected to 1% agarose gel electrophoresis, and a specific band with a size of about 1300bp was detected and sequenced.

[0076] Sequencing results showed that a band with a size of 1243bp was amplified by PCR, and its nucleotide sequence was shown in sequence 1, and the gene shown in positions 69-1208 of sequence 1 was named BpbHLH9. The amino acid sequence of the protein encoded by the ...

Embodiment 2

[0087] Example 2, the acquisition of BpbHLH9 yeast and the impact of BpbHLH9 on squalene and total triterpene content

[0088] 1. Acquisition of BpbHLH9-transformed yeast

[0089] 1. Construction of yeast expression vector

[0090] Insert the BpbHLH9 gene sequence shown at positions 24-1241 of Sequence 1 between the BamHI restriction sites of the vector pYES3 / CT (Invitrogen, catalog number V8253-20), and keep other sequences of the vector pYES3 / CT unchanged, The yeast expression vector pYES3-bHLH9 was obtained. Yeast expression vector pYES3-bHLH9 expresses BpbHLH9 protein.

[0091]The DNA sequence shown in Sequence 3 was inserted between the HindIII restriction sites of the vector pYES2 (Invitrogen, catalog number V825-20), and the other sequences of the vector pYES2 were kept unchanged to obtain the yeast expression vector pYES2-SS. Wherein, the 53rd-1294th position of sequence 3 is the BpSS gene sequence, and the BpSS protein encoded by it is squalene synthase.

[0092] ...

Embodiment 3

[0127] Example 3, the acquisition of BpbHLH9 birch and the functional analysis of BpbHLH9

[0128] 1. Obtaining BpbHLH9 Baihua

[0129] 1. Construction of expression vector

[0130] Insert the BpbHLH9 nucleotide sequence shown in the 67th-1205th position of Sequence 1 between the Nco1 restriction sites of the vector pCAMBIA1303 (Youbao Biology, catalog number VT1844), and keep other sequences of the pCAMBIA1303 vector unchanged to obtain expression Vector pCAMBIA1303-BpbHLH9.

[0131] 2. Construction of recombinant bacteria

[0132] The expression vector pCAMBIA1303-BpbHLH9 was transformed into LBA4404 Agrobacterium tumefaciens (Beijing Dingguo Biotechnology Co., Ltd., catalog number: MCC026) to obtain the recombinant strain LBA4404-pCAMBIA1303-BpbHLH9.

[0133] 3. Acquisition and identification of BpbHLH9 birch

[0134] Agrobacterium tumefaciens LBA4404 containing the expression vector pCAMBIA1303-BpbHLH9 was used to infect the leaves, petioles and stems of birch tissue c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of a betula platyphylla suk. bHLH9 protein and related biomaterials in regulation of synthesis of triterpenoids. Experiments prove that over expression of a BpbHLH9 gene can increase the content of triterpenoids and triterpenoid precursors in transgenic yeast and transgenic betula platyphylla suk., wherein improvement of the content of oleanolic acid is the most significant. The relative expression quantities of triterpenoid pathway key enzyme genes in the transgenic betula platyphylla suk. are all up-regulated to a different extent. The results show thatthe BpbHLH9 gene is involved in the synthesis of the betula platyphylla suk. triterpenoids, and the expression of the triterpenoid pathway key enzyme genes and the content of the triterpenoids such as oleanolic acid, betulinic acid and betulin can be effectively improved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the application of birch bHLH9 protein in regulating the synthesis of triterpenoids. Background technique [0002] Birch bark contains a variety of triterpenoid active substances, mainly including betulin, betulinic acid and oleanolic acid, which have anti-HIV and tumor suppression (neuroma, melanoma, cervical tumor, breast tumor, leukemia and Myeloma) pharmacological activity, and low toxicity and high efficiency, known as the most potential new pharmaceutical preparations, its further development, utilization is of great significance. [0003] In recent years, with the expansion of the population and the increasing demand for natural medicines, the contradiction between the production of natural medicines and the sustainable development of natural resources has been exacerbated. The development of cell engineering and metabolic genetic engineering has enabled people to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N15/81C12N1/19A01H5/00A01H6/00
Inventor 尹静詹亚光李欣肖佳雷张梦岩李影常存
Owner NORTHEAST FORESTRY UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More