Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer and probe composition for detecting V600E of BRAF (V-Raf Murine Sarcoma Viral Oncogene Homolog B1) gene and detecting method of primer and probe composition

A primer-probe and combination technology, applied in the medical and biological fields, can solve the problems of accuracy dependence, inability to directly, objectively and accurately reflect the detection results, and low proportion of ctDNA, to optimize the annealing temperature, improve the sensitivity and accuracy The effect of optimization of sex and PCR cycle number

Pending Publication Date: 2018-07-13
江西海普洛斯医学检验实验室有限公司
View PDF8 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The existing cancer gene detection methods have the following defects and deficiencies: First, the traditional detection optimization method mainly relies on the experience of technicians to interpret the results, which cannot directly, objectively and accurately reflect the detection results, nor can it perform absolute quantification of DNA; Second, the existing detection optimization method based on the BRAF gene V600E site usually has high requirements on the total amount and quality of cfDNA in the sample, and is easily affected by a large amount of blood-related DNA and reaction inhibitors; third, the existing BRAF gene V600E-based The detection optimization method of the site is cumbersome, and the detection sensitivity is low, and there will be a certain amount of false positive detection results, especially the cfDNA false positive detection rate in plasma samples is higher, because cfDNA is mainly derived from benign germline origin. cells, the proportion of ctDNA is relatively low; fourth, there are literatures showing that the addition of carrier RNA in the cfDNA extraction process does not increase the total amount of cfDNA extraction, and it is likely to cause large fragments of gDNA to aggregate.
Fourth, the steps of liquid biopsy are cumbersome, the cycle is long, and the cost is high, so it is not suitable for the detection of single or two sites
These detection methods have many disadvantages, for example: the detection of the whole genome or the whole exome, although the detection content is rich, but the cost is high, and most of the detected information has nothing to do with the corresponding cancer of the patient; the accuracy of FISH detection results The accuracy is highly dependent on the experience and skills of the testing personnel; the second-generation high-throughput sequencing detection steps are cumbersome, the workload is heavy, the detection cycle is long, and the cost of mutation information for only 1-2 gene loci is high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and probe composition for detecting V600E of BRAF (V-Raf Murine Sarcoma Viral Oncogene Homolog B1) gene and detecting method of primer and probe composition
  • Primer and probe composition for detecting V600E of BRAF (V-Raf Murine Sarcoma Viral Oncogene Homolog B1) gene and detecting method of primer and probe composition
  • Primer and probe composition for detecting V600E of BRAF (V-Raf Murine Sarcoma Viral Oncogene Homolog B1) gene and detecting method of primer and probe composition

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] The assembly of embodiment 1 kit

[0067](1) Design of probes and primers: Design specific primers for the upstream and downstream of the BRAF gene V600E target region; use the Taqman probe method to design, and design corresponding mutant and wild-type sequences for the BRAF gene V600E mutant and wild-type sequences Type probes, upstream and downstream primers, and wild-type and mutant detection probes were synthesized by Suzhou Synbio Biotechnology Co., Ltd.

[0068] Specific primers for the PCR amplification upstream and downstream primers of the BRAF gene V600E site are as follows:

[0069] SEQ ID NO.3 is CTACTGTTTTTCCTTTACTTACTACCCTCAG;

[0070] SEQ ID NO.4 is ATCCAGACAACTGTTCAAACTGATG;

[0071] The mutant fluorescent detection probe includes FAM fluorescent group, mutation site binding sequence, MGB modification group and NFQ quenching group from the 5' end to the 3' end. This probe is annealed with the BRAF gene V600E mutant site binding;

[0072] The specifi...

Embodiment 2

[0080] Example 2 Extraction of cfDNA

[0081] 1. Take 2 mL of peripheral blood and process it within 4 hours of obtaining the blood, including the following steps:

[0082] (1) Centrifuge the peripheral blood at 1600g at 4°C for 10 minutes to separate blood cells and plasma (supernatant), and store the blood cells at -80°C;

[0083] (2) The plasma sample was centrifuged for the second time at 16,000 g at 4°C for 10 min, the supernatant was removed and transferred to a preservation tube, and stored at -80°C.

[0084] 2. Use nucleic acid extraction or purification (ZD-YL-Midi-40) for cfDNA extraction, the extraction steps are as follows:

[0085] (1) Take a clean 10mL centrifuge tube, add 10μL Proteinase K, then add 2mL plasma collected in step 1 and 2mL solution GH, vortex mix for 15s, and then incubate in a constant temperature water bath at 37°C for 10min;

[0086] (2) Add 2 mL of isopropanol (plasma: GH: isopropanol = 1:1:1) to the above mixture, vortex and mix thoroughly ...

Embodiment 3

[0097] Example 3 BRAF gene V600E site detection

[0098] 1. Prepare the reaction system:

[0099] (1) Design of probes and primers: Design specific primers for the upstream and downstream of the BRAF gene V600E target region; use the Taqman probe method to design, and design corresponding mutant and wild-type sequences for the BRAF gene V600E mutant and wild-type sequences Type probes, upstream and downstream primers, and wild type and mutant detection probes were synthesized by Suzhou Synbio Biotechnology Co., Ltd.;

[0100] Specific primers for the PCR amplification upstream and downstream primers of the BRAF gene V600E site are as follows:

[0101] SEQ ID NO.3 is CTACTGTTTTTCCTTTACTTACTACCCTCAG;

[0102] SEQ ID NO.4 is ATCCAGACAACTGTTCAAACTGATG;

[0103] The mutant fluorescent detection probe includes FAM fluorescent group, mutation site binding sequence, MGB modification group and NFQ quenching group from the 5' end to the 3' end. This probe is annealed with the BRAF ge...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer and probe composition for detecting V600E of a BRAF (V-Raf Murine Sarcoma Viral Oncogene Homolog B1) gene and a detecting method of the primer and probe composition. The primer and probe composition comprises a mutant probe which aims at a V600E site of the BRAF gene and is as shown in SEQ ID NO.1, a wild type probe which aims at the V600E site of the BRAF gene andis as shown in SEQ ID NO.2 and specific primers which aim at the V600E site of the BRAF gene and are as shown in SEQ ID NO.3 to SEQ ID NO.4. Primer designing and probe modification are carried out ona specific zone aiming at the V600E site, a primer and a probe are matched with each other, ddPCR (Differential Display Polymerase Chain Reaction) is combined with a high-specificity primer and probecomposition, extraction of cfDNA (Cell-free DNA), recycle number of PCR and annealing temperature are optimized, all steps are in a synergistic effect, the accuracy, the stability and the sensitivityfor detection are finally increased, and wide application prospect and a market value are obtained.

Description

technical field [0001] The invention relates to the fields of medicine and biotechnology, in particular to a primer probe composition for detecting BRAF gene V600E and a detection method thereof. Background technique [0002] The BRAF gene is located on chromosome arm 7q34 and encodes the BRAF protein, while the serine-threonine kinase is part of the Ras-Raf-Mek-Erk-MAPK (mitogen-activated protein kinase) signaling cascade, the activation of which involves promoting cellular growth, proliferation and differentiation. There are three functional RAF proteins in humans, ARAF, BRAF and CRAF. Among them, BRAF has the highest basal kinase activity and is the most potent activator of the MAPK pathway. The BRAF gene consists of 18 exons, and the most common activating mutation is located in exon 15 at nucleotide position 1799, converting thymine to adenine, which results in the substitution of glutamic acid for valine at position 600, It was named V600E. The mutation occurs with...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6851C12N15/11
CPCC12Q1/6851C12Q2563/159C12Q2563/107C12Q2545/113
Inventor 刘园园文明新张晓妮程延年
Owner 江西海普洛斯医学检验实验室有限公司
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More