Primer and probe composition for detecting V600E of BRAF (V-Raf Murine Sarcoma Viral Oncogene Homolog B1) gene and detecting method of primer and probe composition
A primer-probe and combination technology, applied in the medical and biological fields, can solve the problems of accuracy dependence, inability to directly, objectively and accurately reflect the detection results, and low proportion of ctDNA, to optimize the annealing temperature, improve the sensitivity and accuracy The effect of optimization of sex and PCR cycle number
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0066] The assembly of embodiment 1 kit
[0067](1) Design of probes and primers: Design specific primers for the upstream and downstream of the BRAF gene V600E target region; use the Taqman probe method to design, and design corresponding mutant and wild-type sequences for the BRAF gene V600E mutant and wild-type sequences Type probes, upstream and downstream primers, and wild-type and mutant detection probes were synthesized by Suzhou Synbio Biotechnology Co., Ltd.
[0068] Specific primers for the PCR amplification upstream and downstream primers of the BRAF gene V600E site are as follows:
[0069] SEQ ID NO.3 is CTACTGTTTTTCCTTTACTTACTACCCTCAG;
[0070] SEQ ID NO.4 is ATCCAGACAACTGTTCAAACTGATG;
[0071] The mutant fluorescent detection probe includes FAM fluorescent group, mutation site binding sequence, MGB modification group and NFQ quenching group from the 5' end to the 3' end. This probe is annealed with the BRAF gene V600E mutant site binding;
[0072] The specifi...
Embodiment 2
[0080] Example 2 Extraction of cfDNA
[0081] 1. Take 2 mL of peripheral blood and process it within 4 hours of obtaining the blood, including the following steps:
[0082] (1) Centrifuge the peripheral blood at 1600g at 4°C for 10 minutes to separate blood cells and plasma (supernatant), and store the blood cells at -80°C;
[0083] (2) The plasma sample was centrifuged for the second time at 16,000 g at 4°C for 10 min, the supernatant was removed and transferred to a preservation tube, and stored at -80°C.
[0084] 2. Use nucleic acid extraction or purification (ZD-YL-Midi-40) for cfDNA extraction, the extraction steps are as follows:
[0085] (1) Take a clean 10mL centrifuge tube, add 10μL Proteinase K, then add 2mL plasma collected in step 1 and 2mL solution GH, vortex mix for 15s, and then incubate in a constant temperature water bath at 37°C for 10min;
[0086] (2) Add 2 mL of isopropanol (plasma: GH: isopropanol = 1:1:1) to the above mixture, vortex and mix thoroughly ...
Embodiment 3
[0097] Example 3 BRAF gene V600E site detection
[0098] 1. Prepare the reaction system:
[0099] (1) Design of probes and primers: Design specific primers for the upstream and downstream of the BRAF gene V600E target region; use the Taqman probe method to design, and design corresponding mutant and wild-type sequences for the BRAF gene V600E mutant and wild-type sequences Type probes, upstream and downstream primers, and wild type and mutant detection probes were synthesized by Suzhou Synbio Biotechnology Co., Ltd.;
[0100] Specific primers for the PCR amplification upstream and downstream primers of the BRAF gene V600E site are as follows:
[0101] SEQ ID NO.3 is CTACTGTTTTTCCTTTACTTACTACCCTCAG;
[0102] SEQ ID NO.4 is ATCCAGACAACTGTTCAAACTGATG;
[0103] The mutant fluorescent detection probe includes FAM fluorescent group, mutation site binding sequence, MGB modification group and NFQ quenching group from the 5' end to the 3' end. This probe is annealed with the BRAF ge...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap