Method for improving yield of glycolic acid in Escherichia coli

A technology of Escherichia coli and glycolic acid, applied in the field of bioengineering, can solve the problems of limited growth of bacteria and accumulation of acetic acid, and achieve the effect of reducing the accumulation of acetic acid and increasing the yield

Active Publication Date: 2018-07-24
HUNAN NORCHEM PHARMACEUTICAL CO LTD
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the process of increasing the yield of glycolic acid only by adjusting the expression levels of the above three key genes, the growth of bacteria will be limited and a large amount of acetic acid will accumulate.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving yield of glycolic acid in Escherichia coli
  • Method for improving yield of glycolic acid in Escherichia coli
  • Method for improving yield of glycolic acid in Escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Construction of recombinant plasmid pJNU-5 and acquisition of recombinant strains

[0024] Using Escherichia coli MG1655(DE3) genome as template to amplify target gene gltA by PCR

[0025] (pJNU-5F:TTAGGATCCAAGGAGATATAATGGCTGATACAAAAGCAAA, pJNU-5R:CGCAAGCTTTTAACGCTTGATATCGCTTTTA).

[0026] BamH I and Hind III double-digested the PCR-amplified gene fragment at 37°C for 2 hours, purified it with a PCR product purification kit, BamH I and Hind III double-digested plasmid pCDFDuet-1 at 37°C for two hours, and recovered the vector fragment with a gel recovery kit. T4 ligase to treat the target gene fragment and the carrier fragment, and treat at 16°C for 8-10 hours, add the above ligation reaction solution to 100 μL Escherichia coli JM109 transformation competent medium, place on ice for 30min, heat shock at 42°C for 90s, add 1mL LB liquid culture base, incubated at 37°C for 1 h on a shaker, and coated with streptomycin-resistant plates (50 mg / L). After culturin...

Embodiment 2

[0027] Embodiment 2: Construction of recombinant plasmid pJNU-4

[0028] The plasmid pTrc99A was digested with EcoR I and BamHI to obtain the vector fragment. EcoR I and BamHI double digestion plasmid pGLY-2 (disclosed in Dhamankar, H.; Tarasova, Y.; Martin, C.H.; Prather, K.L., Engineering E. coli for the biosynthesis of 3-hydroxy-γ-butyrolactone (3HBL) and 3,4-dihydroxybutyric acid (3,4-DHBA) as value-added chemicals from glucose as asole carbon source. Metabolic Engineering 2014, 25, 72-81.), to obtain the target gene (ycdW, aceAK) fragment. T4 ligase to treat the target gene fragment and the carrier fragment, and treat at 16°C for 8-10 hours, add the above ligation reaction solution to 100 μL Escherichia coli JM109 transformation competent medium, place on ice for 30min, heat shock at 42°C for 90s, add 1mL LB liquid culture base, incubated at 37°C for 1 h on a shaker, and coated with ampicillin-resistant plates (100 mg / L). The positive clones were picked for verification...

Embodiment 3

[0029] Example 3: Knockout of lactate dehydrogenase gene ldhA in MG1655 (DE3)

[0030] ldhA (lactate dehydrogenase) was knocked out by λ-Red recombinant method. The specific implementation steps are as follows. Using pKD4 as a template, using primer ko-ldhA F:

[0031] GTGTAGGCTGGAGCTGCTTC,ko-ldhA

[0032] R: ATGGGAATTAGCCATGGTCC amplifies the knockout frame, which contains 39 bp of homology arms at both ends of the target gene, two FRT sites and the Kana resistance gene. The MG1655 (DE3) strain transformed with pKD46 was inoculated in LB medium, cultivated overnight at 30°C, and then transferred to 50mL LB medium with a 1% inoculum size, while adding 100mg / L ampicillin and 10mM arabinose, 30 Cultivate to OD 600 =0.4~0.6, the three proteins on pKD46 can be fully expressed. Pre-cool on ice for 30 minutes, collect the bacteria by centrifugation at 5000r / min, then wash once with sterile water and twice with 10% glycerol, concentrate the final bacteria into 500 μL compete...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for improving a yield of glycolic acid in Escherichia coli and belongs to the technical field of bioengineering. According to the method disclosed by the invention, astrain of genetically engineered bacterium Mgly145 of citroyl synthetase shown in overexpression SEQ ID NO.1 is constructed; a glycolic acid yield of the genetically engineered bacterium in shake flask fermentation is 1.369g / L, and a productive rate is 0.504g / g-glucose; compared with genetically engineered bacterium Mgly14, the glycolic acid yield is improved by 30.9%; compared with Mgly14 in batch fermentation, the glycolic acid yield of the Mgly145 is improved by 8.8%, the productive rate is improved by 14.6%, and furthermore, acetic acid accumulation is reduced by 67.5%.

Description

technical field [0001] The invention relates to a method for increasing the yield of glycolic acid in Escherichia coli, belonging to the technical field of bioengineering. Background technique [0002] Glycolic acid (glycolate), also known as glycolic acid and glycolic acid, is the simplest α-hydroxy acid. In recent years, glycolic acid has been widely used in textile industry, medical engineering materials, chemical cleaning and many other fields, and the demand is increasing year by year. [0003] Many approaches to glycolate production using total biosynthesis have been reported, exploiting the glyoxylate cycle in microorganisms - overexpressing the isocitrate lyase gene aceA, the glyoxylate reductase gene ycdW and isocitrate dehydrogenase The kinase / phosphorylase gene, aceK, achieves glycolic acid accumulation using either glucose or xylose as substrates. However, in the process of improving the yield of glycolic acid only by adjusting the expression levels of the abov...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/70C12P7/42C12R1/19
CPCC12N9/1025C12N15/70C12P7/42C12Y203/03001
Inventor邓禹马宁张晓娟毛银赵运英
OwnerHUNAN NORCHEM PHARMACEUTICAL CO LTD