Umbilical cord mesenchymal stem cells modified by NTF4 (neurotrophin 4) gene and construction method and application thereof
A technology of NTF4 and mesenchymal stem cells, applied in the field of stem cells, can solve problems such as threats to human health and residual paralysis, and achieve the effect of strong combination, promotion of cell regeneration and repair, and protection of nerve cells
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0061] The construction of embodiment 1NTF4 gene recombination plasmid vector
[0062] (1) Obtain NTF4 gene by PCR
[0063] Using the pcDNA3.0-NTF4-Flag plasmid as a template, the complete sequence of NTF4 coding was amplified with primers F: 5'CGGAATTCCGATGGAGGGAGAGG 3' and R: 5'CGGGATCCCGTCAGGCCCGGCC 3'. The PCR reaction parameters were: pre-denaturation at 94°C for 2 min; denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, 30 cycles; extension at 72°C for 1 min, and incubation at 10°C. The product was identified and separated by 1% agarose gel electrophoresis, and the NTF4 amplified fragment was recovered and purified using a DNA gel recovery kit. The target fragment size was about 633bp. Among them, the pcDNA3.0-NTF4-Flag plasmid was preserved by the laboratory, the agarose and DNA marker were purchased from Beijing Quanshijin Biological Company, and the DNA polymerase used in PCR amplification was KOD high-fidelity polymerase, which wa...
Embodiment 3
[0071] The construction of the umbilical cord mesenchymal stem cell of embodiment 3NTF4 gene modification
[0072] Take P2 generation human umbilical cord mesenchymal stem cells from liquid nitrogen, resuscitate, use 6cm culture dish to subculture and plate, when the human umbilical cord mesenchymal stem cells grow to 70% cell confluence, absorb the culture medium in the culture dish, add CD513B vector respectively Add 1 mL of lentivirus venom and CD513B-NTF4 lentivirus venom and an equal volume of culture medium, and add polybrene at the same time. 2 cultured overnight in a cell culture incubator. After 24 hours, the infection solution was discarded and fresh complete medium was replaced to continue the culture. The lentiviral transfection efficiency was detected by a fluorescence microscope. After 48 hours, hU-MSCs were observed to emit green fluorescence under a fluorescence microscope, indicating that the infection was successful. The final concentration of puromycin was ...
Embodiment 4
[0074] Example 4 Western blot detection method to detect the expression of NTF4 in NTF4 gene-modified umbilical cord mesenchymal stem cells
[0075] The total protein in the NTF4 / hUC-MSCs cell line stably expressing NTF4 and the blank modified BV / hUC-MSCs cell line were extracted respectively, and the protein concentration of the extracted protein was determined by the BCA method. Acrylamide gel electrophoresis. After electrophoresis, the protein on the gel was transferred to PVDF membrane by electrophoresis, and the mass fraction was 5% skimmed milk powder, which was blocked at room temperature for 2 hours. Incubate rabbit anti-human NTF4 antibody (1:1000 dilution) and internal reference rabbit respectively. Anti-human β-tubulin antibody (diluted 1:5000), incubated overnight at 4°C, washed PVDF membrane with PBST shaker (3 times, 5min each), incubated HRP-labeled goat anti-rabbit antibody (diluted 1:2000) at room temperature for 2h, Wash the PVDF membrane with PBST shaker (3 ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap