Method for producing beta-alanine and D-aspartic acid through conversion with biological enzyme method

A technology of aspartic acid and biological enzyme method, applied in the field of enzyme catalysis, can solve the problems of unsuitability for industrialization and low yield, and achieve the effects of reducing fermentation cost, convenient operation and saving labor cost.

Inactive Publication Date: 2018-11-20
SICHUAN TONGSHENG BIOTECH
View PDF6 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The existing enzymatic methods for synthesizing β-alanine and D-aspartic acid are either too low in yield, or have to manually add solid substrates continuously during the biotransformation process, which are not suitable for industrial production. Problem, the present invention provides a method for the production of β-alanine and D-aspartic acid by enzymatic conversion. The optimal pH condition of the enzyme saves a lot of manpower and is conducive to the industrial production of biological synthesis of β-alanine and D-aspartic acid

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing beta-alanine and D-aspartic acid through conversion with biological enzyme method
  • Method for producing beta-alanine and D-aspartic acid through conversion with biological enzyme method
  • Method for producing beta-alanine and D-aspartic acid through conversion with biological enzyme method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Embodiment 1: Construction of recombinant expression vector

[0055] The gene sequence of Bacillus subtilis L-aspartate-α-decarboxylase (PanD) obtained from the NCBI database, in order to delete the fusion expression located between the multiple cloning site and the T7 promoter on the expression vector Tag the protein to avoid the impact on the recombinant PanD protease activity, so add restriction enzyme sites NdeI (CATATG) and XhoI (CTCGAG) at both ends of the PanD gene sequence, where the 5th end of the PanD gene is NdeI, and the 3rd end is XhoI . as follows:

[0056] GC CATATG TACCGTACCATGATGTCTGGTAAACTGCACCGTGCTACCGTTACCGAAGCTAACCTGAACTACGTTGGTTCTATCACCATCGACGAAGACCTGATCGACGCTGTTGGTATGCTGCCGAACGAAAAAGTTCAGATCGTTAACAACAACAACGGTGCTCGTCTGGAAACCTACATCATCCCGGGTAAACGTGGTTCTGGTGTTATCTGCCTGAACGGTGCTGCTGCTCGTCTGGTTCAGGAAGGTGACAAAGTTATCATCATCTCTTACAAAATGATGTCTGACCAGGAAGCTGCTTCTCACGAACCGAAAGTTGCTGTTCTGAACGACCAGAACAAAATCGAACAGATGCTGGGTAACGAACCGGCTCGTACCATCCTGTAA CTCGAG CG...

Embodiment 2

[0060] Embodiment 2: the acquisition of engineering bacteria

[0061] The operation steps are as follows:

[0062] (1) Take a tube of 50 μL E.coli Rosetta (DE3) competent cells and place them on ice. After the competent cells are completely thawed, gently blow with a pipette to suspend the competent cells evenly.

[0063] (2) Pipette 1 μL of the pET32a-panD recombinant plasmid, add it to E.coli Rosetta (DE3) competent cells, mix gently by pipetting, and let stand on ice for 30 minutes.

[0064] (3) Heat shock in a metal bath at 42°C for 90 seconds, and immediately place it on ice for 2 minutes.

[0065] (4) Add 500 μL of LB medium without antibiotics, recover at 37° C., 220 rpm for 1 hour.

[0066] (5) Centrifuge at 4000rpm for 5min, pipette 300μ supernatant with a pipette gun, discard, and gently pipette to suspend the cells.

[0067] (6) Under a sterile environment, use a coating rod to evenly spread the cells on the LB solid medium plate (Amp resistance), control the tem...

Embodiment 3

[0069] Embodiment 3: Fermentation and biotransformation of engineering bacteria DPD to synthesize β-alanine

[0070] (1) Under sterile conditions, inoculate 0.1% to 1% of the inoculum from the engineered bacteria DPD glycerol tube into the primary seed medium, cultivate at 37°C and 220 rpm until the OD600 reaches 3.0 to 4.0, and stop the cultivation.

[0071] (2) Transfer the primary seed bacterial liquid to the secondary seed culture medium according to the inoculum amount of 4%-10%, and cultivate for 3-5 hours at a temperature of 37° C. and a rotational speed of 220 rpm.

[0072] (3) Transfer the cultured secondary seed bacterial liquid into a 5L fermenter (containing 3L fermentation medium) by flame inoculation at an inoculum size of 1% to 8%, initial fermentation parameters: temperature 37°C, rotating speed 200rpm, pH=7.0, ventilation rate 50L / h, tank pressure 0.05MPa; as the fermentation time prolongs, the bacterial concentration gradually increases, and the dissolved oxy...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Yieldaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of enzyme catalysis, particularly relates to a method for producing beta-alanine and D-aspartic acid through conversion with a biological enzyme method, and aims to solve the problem that existing methods for synthetizing the beta-alanine and the D-aspartic acid with the biological enzyme method are not suitable for industrialization due to the fact that the existing methods are too low in yield or solid substrates are required to be manually and uninterruptedly added in biological conversion processes. According to the technical scheme, the methodcomprises steps as follows: [1] engineered Escherichia coli for overexpression of L-aspartate decarboxylase is obtained through high-density fermentation; [2] biological conversion is performed by theaid of the engineered Escherichia coli by using DL-aspartic acid as a substrate, a DL-sodium aspartate solution is fed for substrate addition during conversion, meanwhile, the pH of the conversion system is controlled through feeding of a DL-aspartate hydrochloride solution, and the beta-alanine and the D-aspartic acid are obtained. The beta-alanine can be synthetized separately by replacing thesubstrate with L-aspartic acid. The method is applicable to synthesis of the beta-alanine and D-aspartic acid.

Description

technical field [0001] The invention belongs to the technical field of enzyme catalysis, and in particular relates to a method for producing beta-alanine and D-aspartic acid through biological enzymatic conversion. Background technique [0002] β-alanine, also known as β-alanine, is the only β-amino acid that exists in nature, and is mainly used in food, medicine and chemical industries. In food, it is mainly used as food additive; in medicine, it is mainly used in the synthesis of sodium pamidronate and anti-colon drug balsalazide, which inhibit tumor bone metastasis; in chemical industry, it is mainly used in the synthesis of calcium pantothenate and carnosine. D-aspartic acid is an important chiral compound, mainly used in the synthesis of drug precursors and intermediates, such as N-methyl-D-aspartic acid sodium, apoxicillin and D-aspartic acid Acid-β-hydroxylamine, etc.; can also participate in the synthesis of side chains of some antibiotics (such as β-lactam antibiot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P13/06C12P13/20C12N15/70C12N15/66C12N15/60C12N1/21C12R1/19
CPCC12N1/20C12N9/88C12N15/66C12N15/70C12N2800/22C12P13/06C12P13/20C12Y401/01011
Inventor李晚军王苓刘超曾帅刘鑫杨顺楷陈纹锐
OwnerSICHUAN TONGSHENG BIOTECH