Detection kit for varicella-herpes zoster virus neutralizing antibody and detection method for varicella-herpes zoster virus neutralizing antibody

A technology of herpes zoster virus and detection kit, which can be applied to measurement devices, instruments, scientific instruments, etc., can solve problems such as poor sensitivity, and achieve the effects of accurate selection, saving production costs, and eliminating non-specific binding.

Active Publication Date: 2018-12-25
WUHAN LIFE TECH
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the ELISA kits currently available on the market are coated with whole virus antigens, so the sensitivity is poor

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection kit for varicella-herpes zoster virus neutralizing antibody and detection method for varicella-herpes zoster virus neutralizing antibody
  • Detection kit for varicella-herpes zoster virus neutralizing antibody and detection method for varicella-herpes zoster virus neutralizing antibody
  • Detection kit for varicella-herpes zoster virus neutralizing antibody and detection method for varicella-herpes zoster virus neutralizing antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1: Preparation of recombinant expression of varicella-zoster virus glycoprotein E antigen

[0041] 1. Target gene amplification

[0042] (1) Primer design

[0043]According to the varicella-zoster virus glycoprotein E gene sequence published on Genbank, select the nucleic acid sequence corresponding to the amino acid sequence 25-537 to design primers with Nhe I and EcoR I restriction sites (marked in italics) at both ends:

[0044] SEQID NO.1: The forward primer is (5'-3'): tactaactagcatgaccaatccagttcgaaccagcgtac;

[0045] SEQID NO.2: The reverse primer is (5'-3'):

[0046] ttccggaattcttaatgatgatgagacagatgacgcagcagagaccttgtaaccggat;

[0047] (2) PCR amplification

[0048] The varicella-zoster virus glycoprotein E gene was amplified by RT-PCR, and the varicella-zoster virus glycoprotein E gene RT-PCR product and pET-32a(+) vector were simultaneously amplified with EcoR I and HindⅢ Enzyme digestion, recovery of the target fragment, quantification of the targe...

Embodiment 2

[0060] Example 2: Preparation of a detection kit for detecting varicella-zoster virus neutralizing antibody

[0061] The preparation of the ELISA plate is as follows: Dilute the recombinant expression varicella-zoster virus glycoprotein E antigen prepared in Example 1 to 20pg / mL, add 20ul / well to the wells of the 96-well plate, and add 5 to 10 Microliter 2% to 5% glutaraldehyde solution, shake the 96-well plate horizontally, mix well, react at room temperature for 10 minutes, and the solution in the well is solidified, ready for use; block with 0.5% bovine serum albumin at 30°C for 2 hours, wash with washing solution , pat dry.

Embodiment 3

[0062] Embodiment 3: sample detection

[0063] 1. Dilute the sample to be tested to an appropriate concentration with the sample diluent (0.5mol / L carbonate buffer solution with pH=9.5, adding bovine serum albumin with a mass concentration of 1%), and dilute the sample with the sample diluent at the same time. The human anti-VZV serum of the standard sample is serially diluted to make a standard curve; the standard sample comes from a cured varicella patient, and the titer of the human anti-VZV serum calibrated by the VZVIgG international standard.

[0064] Human anti-VZV serum (from patients with cured varicella whose potency has been calibrated by VZV IgG international standard), was diluted with the above sample diluent to 2IU / ml, 1.8IU / ml, 1.6IU / ml, 1.4IU / ml, 1.2IU / ml, 1.0IU / ml, 0.8IU / ml, 0.6IU / ml, 0.4IU / ml, 0.2IU / ml, a total of 10 concentrations. Each concentration was then diluted 100 times with R1 for use. To the wells of each cell density, add 50 microliters of human...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a detection kit for a varicella-herpes zoster virus neutralizing antibody and a detection method for the varicella-herpes zoster virus neutralizing antibody. The detection kitcomprises a recombination expression varicella-herpes zoster virus glycoprotein E antigen, a sample dilution solution, 20-times concentrated washing solution, an enzyme-labelled second antibody, a substrate, a stop solution, standard serum and negative control. The recombination expression varicella-herpes zoster virus glycoprotein E antigen is a recombination expression plasmid transformation escherichia coli which is constructed by connecting a VZV-gE gene and a recombination expression vector pET-32a(+) vector, wherein the VZV-gE gene is optimized to be a escherichia coli preferred codon,and expressed recombinant protein is cloned, cultured and induced. The antigen used in the detection kit is the recombination expression varicella-herpes zoster virus glycoprotein E antigen, the safety is good, and pollution to the environment is not caused. The recombination expression varicella-herpes zoster virus glycoprotein E antigen is prepared by genetic engineering, the specificity is high, the quality is pure, and the cost is relatively low; and antigen site selection is accurate, coupling is good, nonspecific binding can be effectively excluded, the measurement error is reduced, andthe appearance of false negative and false positive is reduced.

Description

technical field [0001] The invention relates to the technical field of in vitro diagnostic reagents, in particular to a detection kit for varicella-zoster virus neutralizing antibodies and a detection method thereof. Background technique [0002] Varicella virus belongs to the family Herpesviridae. Virus particles are polygonal or spherical, enveloped, and spikes composed of glycoproteins are distributed on the surface. Studies have shown that there are 7 viral glycoproteins on the surface of varicella-zoster virus (VZV) particles, and these glycoproteins are respectively related to the infection process such as virus invasion and reproduction. The live attenuated varicella vaccine currently used for immunization is composed of complete virus particles, and the vaccine contains all virus surface antigens. In theory, antibodies that can bind to all surface glycoproteins can be produced after vaccination, thereby blocking the infection of varicella virus process. Although th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): G01N33/569G01N33/535
CPCG01N33/535G01N33/56994
Inventor王诺曾强彭芳霁黄晶吴边谢张婷徐云尹新涛丁建华张薇尹碧
OwnerWUHAN LIFE TECH