Construction and application of recombinant strain converting L-threonine to L-2-aminobutyric acid

A technology of aminobutyric acid and threonine deaminase, applied in the direction of microorganism-based methods, bacteria, microorganisms, etc., can solve the problems of low efficiency of coenzyme cycle regeneration, complex multi-enzyme addition, long conversion time, etc., and achieve low cost , high product optical purity and high conversion efficiency

Active Publication Date: 2019-01-25
JIANGNAN UNIV
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the multi-enzyme conversion process often faces problems such as low enzyme activity, low enzyme stability, low efficiency of coenzyme cycle regeneration, complicated multi-enzyme addition, and difficulty in engineering scale-up.
Participating whole cells of recombinant bacteria in transformation can solve the above problems to a certain extent, but there are still problems such as long transformation time and poor transformation effect.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and application of recombinant strain converting L-threonine to L-2-aminobutyric acid
  • Construction and application of recombinant strain converting L-threonine to L-2-aminobutyric acid
  • Construction and application of recombinant strain converting L-threonine to L-2-aminobutyric acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Acquisition of genetically engineered bacteria producing Escherichia coli threonine deaminase

[0034] (1) Escherichia coli W3110 was inoculated in LB medium, cultured at 37°C for 12 hours to collect bacteria, and genomic DNA was extracted using a bacterial genome extraction kit.

[0035](2) Using primers EcTD-1 (5'CGGGATCCATGGCTGACTCGCAACCCCTG 3', SEQ ID NO:8) and EcTD-2 (5'CCCAAGCTTCTAACCCGCCAAAAAGAACCTGAAC 3', SEQ ID NO:9) to clone threonine deaminase from the genome Gene EcTD;

[0036] (3) Connect the target gene to the PMD19simple cloning vector for sequencing, select the correct gene fragment and digest it with BamHI and XhoI, and then connect it to the plasmid pET28a that has been double digested with the same two enzymes;

[0037] (4) Introduce the constructed expression plasmid into E.coli BL21(DE3), screen and verify it on the LB plate containing kanamycin, and select the strain with the correct target gene. The gene sequence is SEQ ID NO:1 , the ...

Embodiment 2

[0040] Example 2: Acquisition of genetically engineered bacteria producing Bacillus thuringiensis leucine dehydrogenase

[0041] (1) Bacillus thuringiensis was inoculated in LB medium, cultured at 37°C for 12 hours to collect the bacteria, and the genomic DNA was extracted using a bacterial genome extraction kit.

[0042] (2) Bacillus thuringiensis leucine was cloned from genomic DNA using primers BtLeuDH-1 (5'CGGGATCCATGCGCGTTATGGTCTTG 3', SEQ ID NO:10) and BtLeuDH-2 (5'CCCAAGCTTTTAGCGACGGCTAATAATATCGTG 3', SEQ ID NO:11) respectively Acid dehydrogenase gene BtLeuDH.

[0043] (3) Connect the target gene to the PMD19simple cloning vector for sequencing, select the correct gene fragment to digest with BamHI and XhoI, and connect it to pET28a that has been double-digested with the same two enzymes;

[0044] (4) Introduce the constructed expression plasmid into E.coli BL21(DE3), screen and verify it on the LB plate containing kanamycin, and select the strain with completely corre...

Embodiment 3

[0047] Embodiment 3: the acquisition of the genetic engineering bacterium that produces formate dehydrogenase

[0048] The codon optimization of the formate dehydrogenase gene (FDH) derived from Candida boidinii (original gene sequence such as SEQ ID NO: 3) makes the gene sequence more suitable for the large intestine expression system. After optimization, the gene sequence is such as SEQ ID NO: 4, and the amino acid sequence is as follows: SEQ ID NO:7. The artificially synthesized FDH gene fragment containing BamHI and XhoI restriction sites was double-digested, and then connected with the expression vector pET28a obtained by the same double-digestion to construct the recombinant plasmid pET28a-FDH, and the recombinant plasmid was transformed into the expression host E. In coli BL21(DE3), screening and verification were carried out on the LB plate containing kanamycin, and the correct positive strain was screened out.

[0049] Inoculate the above codon-optimized engineered b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction and application of a recombinant strain converting L-threonine to L-2-aminobutyric acid, belonging to the field of bioengineering technology. The production method of the invention utilizes a recombinant bacterium expressing two plasmids to simultaneously realize the high-efficient expression of three enzymes, and comprises the steps of: conversion of L-threonine to L-2-aminobutyric acid, coupled with a coenzyme regeneration system, converts NAD+ into NADH, so that the concentration of NADH in the system is relatively stable, and the conversion can be carried out efficiently. Furthermore, the CO<2> converted from ammonium formate can be dissolved in ammonia water, which has little environmental pollution and industrial application value. The method has the advantages of mild conversion condition, strong specificity, low cost and short conversion time. The L-2-aminobutyric acid is prepared adopting the method, 40g / L L-threonine is added, The concentration of the obtained product L-2-aminobutyric acid is 43.3 g / L, and the conversion ratio was over 99.9%.

Description

technical field [0001] The invention relates to the construction and application of a recombinant bacterium that transforms L-threonine to produce L-2-aminobutyric acid, and belongs to the technical field of bioengineering. Background technique [0002] L-2-aminobutyric acid is a non-natural chiral amino acid, which can inhibit the transmission of human nerve information, enhance the activity of glucose phosphatase and promote the metabolism of brain cells. At the same time, 2-aminobutyric acid is also an important chemical raw material and pharmaceutical intermediate, which has been widely used in the synthesis of drugs, such as the synthesis of anti-tuberculosis drug ethambutol hydrochloride and anti-epileptic drug levetiracetam. [0003] At present, the synthesis methods of L-2-aminobutyric acid include chemical methods and biological methods. Chemical methods mainly include ketone butyric acid reduction method, desulfurization reaction method, ammonolysis reaction metho...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12P13/04C12R1/19
CPCC12N9/0008C12N9/0016C12N9/88C12P13/04C12Y102/01002C12Y104/01009C12Y403/01019
Inventor刘立明张君轩付妍刘佳宋伟张灿
OwnerJIANGNAN UNIV