Supercharge Your Innovation With Domain-Expert AI Agents!

A kind of heterologous recombinant Pichia pastoris engineering bacteria gs115-ppic9k-lacgwlf and its application

A technology of GS115 and Pichia pastoris, applied in application, genetic engineering, fermentation, etc., can solve the problems of low expression level, difficulty in renaturation of inclusion bodies, cost of material and financial resources, etc.

Active Publication Date: 2021-05-11
JIANGNAN UNIV
View PDF15 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the expression level of bacterial laccase itself is lower than that of fungal laccase, and it is easy to form inclusion bodies in Escherichia coli. The renaturation of inclusion bodies is relatively difficult and consumes material and financial resources.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of heterologous recombinant Pichia pastoris engineering bacteria gs115-ppic9k-lacgwlf and its application
  • A kind of heterologous recombinant Pichia pastoris engineering bacteria gs115-ppic9k-lacgwlf and its application
  • A kind of heterologous recombinant Pichia pastoris engineering bacteria gs115-ppic9k-lacgwlf and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Construction of recombinant Pichia pastoris expression vector pPIC9K and codon optimization of GWLF gene

[0045] (1) Using the CotA laccase mutant GWLF with greatly improved catalytic activity and expression efficiency constructed in our laboratory as a template, primers were designed to amplify the target gene. The relevant forward and reverse primers designed are as follows:

[0046] GWLF-F: 5′-GCCGGAATTCATGAACCTAGAAAAATTTGT-3′

[0047] GWLF-R:5′-GCCGCCTAGGTTACTGGATGATATCCATCG-3′

[0048] Wherein the underlined parts represent the restriction sites of EcoR I and Avr II respectively. The PCR amplification system is: plasmid DNA 3 μL, front primer (10 μM) 1 μL, back primer (10 μM) 1 μL, PCR SuperMix 25 μL, ddH 2 Make up to 50 μL with O, and the PCR amplification conditions are denaturation at 94°C for 2 min, cycled 30 times (94°C for 30 s, 55°C for 30 s, 72°C for 2 min), and finally extension at 72°C for 5 min.

[0049] Take 5 μL of the PCR product and detect it by...

Embodiment 2

[0053] Expression and purification of embodiment 2 recombinant GWLF

[0054] (1) Expression: The expression vector pPIC9K-LacGWLF was linearized by Sac I single enzyme digestion and purified, and then electrotransformed into a competent strain of Pichia pastoris GS115, using a 2mm electroporation cup to perform electroporation at a voltage of 1.8kV , and positive transformant screening was carried out on the MD plate; the transformant obtained by MD plate screening was used as a template, and 3'AOX (GGCAAATGGCATTCTGACAT) and 5'AOX (GACTGGTTCCAATTGACAAGC) were used as primers for PCR identification, and the correct transformant identified by PCR was Recombinant Pichia pastoris GS115 / pPIC9K-LacGWLF.

[0055] Recombinant Pichia pastoris engineered strains containing 0.3mM ABTS, 0.25mM CuSO 4 and 0.5% methanol on the BMMY plate for primary screening, drop 100 μL of methanol on the plate cover every 24h, and the transformant producing laccase will have a blue-green color circle ar...

Embodiment 3

[0057] The enzyme activity assay of embodiment 3 recombinant GWLF

[0058] (1) Definition of enzyme activity unit: When using the ABTS method to determine the enzyme activity of laccase, define the amount of enzyme required to catalyze the conversion of 1 μmol of substrate into product per minute as an activity unit. Enzyme activity assay steps:

[0059] (1) Preheating: Take 2.4mL of citric acid buffer solution with pH 3.5 in a test tube, add 0.5mL ABTS solution (the final concentration of ABTS is 0.5mM) into the test tube and place it in a water bath at 50°C to preheat for 5 minutes; 2 Reaction: Add diluted 0.1mL sample enzyme solution and shake evenly. 3 Measurement: Use a spectrophotometer to measure the kinetics of the uniformly oscillating sample, measure the change in OD value per minute within 30s at a wavelength of 420nm (the measurement reaction shows a straight line) and calculate the enzyme activity.

[0060] Enzyme Activity Formula: Enzyme Activity

[0061] Sp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a heterologous recombinant Pichia engineering bacterium GS115-pPIC9K-LacGWLF, wherein the heterologous recombinant Pichia engineering bacterium carries a target gene derived from an excellent mutant of Bacillus pumilus CotA laccase GWLF The engineering bacterium obtained by recombining the optimized GWLF laccase gene into the genome of Pichia pastoris GS115. The positive recombinant Pichia pastoris strain of the present invention can be used to prepare recombinant GWLF laccase after undergoing methanol induction culture, optimization of fermentation conditions and high-density fermentation in a 5L fermenter.

Description

technical field [0001] The present invention relates to a CotA laccase mutant GWLF from Bacillus pumilus and its gene, engineering bacteria and preparation method, specifically designed genetic engineering technology and molecular biological means to obtain a recombinant expression strain expressing the novel laccase, and the bacterial laccase The application of enzyme protein in dye decolorization industry belongs to the field of enzyme genetic engineering. Background technique [0002] Laccase (Laccase, E.C.1.10.3.2) is a copper-containing polyphenol oxidase, a member of the blue multi-copper oxidase family, which can be divided into four categories: plant laccase, insect laccase, fungal laccase enzymes and bacterial laccases. It can catalyze the oxidation of various phenolic and non-phenolic compounds to generate corresponding quinones, and at the same time reduce molecular oxygen to water with the transfer of electrons, and no other by-products are formed during the rea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/19C12N9/02C12N15/53C02F3/34C12R1/84
CPCC02F3/342C12N9/0061C12N2800/22C12Y110/03002
Inventor 管政兵夏静廖祥儒
Owner JIANGNAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More