A self-assembled nanomaterial and its preparation method and application

A nanomaterial and self-assembly technology, applied in the field of nanomaterials, achieves the effects of low price, high catalytic activity, and high catalytic kinetic parameters

Active Publication Date: 2022-04-12
THE NAT CENT FOR NANOSCI & TECH NCNST OF CHINA
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, there is no research on the co-assembly of aminoglycoside molecules with designed nucleic acid and heme to improve the substrate conversion number and catalytic efficiency of peroxide mimetic enzymes. However, this method is applied to the detection of nucleic acid recognition targets, which is easy to operate, Low cost, high detection response speed and sensitivity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A self-assembled nanomaterial and its preparation method and application
  • A self-assembled nanomaterial and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] This example prepares self-assembled nanomaterials by the following method

[0062] To 96 μL 50 mM Na 2 HPO 4 / NaH 2 PO 4 1 μL of 100 μM G-DNA, 2 μL of 1 mg / mL chitosan molecule (viscosity of 200 mPa·s, aqueous solution containing 1% acetic acid) and 1 μL of 100 μM hemin (dissolved in di Methyl sulfoxide), the sample addition time interval is 10s, followed by mixing at 25°C for 30min, and the reaction is to obtain the mimetic enzyme, that is, the self-assembled nanomaterial.

[0063] Wherein, the sequence of G-DNA is GGGTAGGGCGGGCGGG, which is purified by HPLC or PAGE.

[0064] Catalytic activity test

[0065] Add 1 μL of 100 mM tetramethylbenzidine (dissolved in DMSO) and 1 μL of 200 mM hydrogen peroxide solution to 100 μL of simulated enzyme solution in sequence. Intermediate product) as a function of time, through the molar extinction coefficient of the oxidation product of tetramethylbenzidine (39000M·cm -1 ), calculate H 2 o 2 The reduction rate and the ox...

Embodiment 2

[0068] This example prepares self-assembled nanomaterials by the following method

[0069] To 90 μL 50 mM K 2 HPO 4 / KH 2 PO 4 1 μL of 100 μM G-DNA, 8 μL of 2 mM / mL paromomycin sulfate aqueous solution and 1 μL of 100 μM hemin (dissolved in dimethyl sulfoxide) were sequentially added to the buffer solution (pH 7.0), and the sample addition time interval was 10 s , followed by mixing at 25° C. for 30 min, and reacted to obtain a mimetic enzyme, that is, a self-assembled nanomaterial.

[0070] Wherein, the sequence of G-DNA is GGTAGGCGGCGGTGGCGGCGGAGG, which is purified by HPLC or PAGE.

[0071] Catalytic activity test

[0072] Add 1 μL 100 mM phenol (dissolved in DMSO), 1 μL 200 mM 4-aminoantipyrine aqueous solution and 1 μL 200 mM hydrogen peroxide aqueous solution to 100 μL simulated enzyme solution successively, the sample addition time is 5 s, record the absorbance at a wavelength of 510 nm ( Indoxyl amino antipyrine dye) changes with time, by the molar extinction coe...

Embodiment 3

[0075] This example prepares self-assembled nanomaterials by the following method

[0076] To 90 μL of 50 mM MES / MES sodium salt buffer solution (pH 7.0, containing 50 mM NaCl), 1 μL of 200 μM G-DNA, 8 μL of 2 mM streptomycin aqueous solution and 1 μL of 100 μM manganese protoporphyrin (dissolved in dimethyl sulfone), the sample addition time interval was 10s, and then mixed at 20°C for 30 minutes, and the reaction was performed to obtain the mimetic enzyme, that is, the self-assembled nanomaterial.

[0077] Wherein, the sequence of G-DNA is GGTAGGCGGCGGTGGCGGCGGAGG, which is purified by HPLC or PAGE.

[0078] Catalytic activity test

[0079] Add 1 μL 100 mM phenol (dissolved in DMSO), 1 μL 200 mM 4-aminoantipyrine aqueous solution and 1 μL 200 mM hydrogen peroxide aqueous solution to 100 μL simulated enzyme solution successively, the sample addition time is 5 s, record the absorbance at a wavelength of 510 nm ( Indoxyl amino antipyrine dye) changes with time, by the molar e...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Viscosityaaaaaaaaaa
Viscosityaaaaaaaaaa
Login to View More

Abstract

The present invention provides a self-assembled nanomaterial and its preparation method and application. The raw materials of the nanomaterial include nucleic acid molecules, aminoglycoside molecules and metal protoporphyrin; the self-assembled nanomaterial provided by the present invention uses aminoglycoside molecules As an activator, the nanomaterial prepared by co-assembly with nucleic acid molecules and metal protoporphyrin, as a simulated enzyme catalyst, has the same order of magnitude of substrate turnover and catalytic efficiency as natural horseradish peroxidase. Because aminoglycoside molecules and metal protoporphyrin, nucleic acid metal protoporphyrin conjugates or nucleic acid metal protoporphyrin self-assembly, aminoglycoside molecules and nucleic acids have a synergistic effect on the catalytic activity of metal protoporphyrin, and have a more High catalytic activity; high application value in chemical sensors and biosensors.

Description

technical field [0001] The invention belongs to the field of nanomaterials, and relates to a self-assembled nanomaterial and its preparation method and application, in particular to a supramolecular self-assembly mimetic enzyme and its preparation method and application. Background technique [0002] Peroxidase-like enzymes based on the coordination assembly of nucleic acid quadruplexes and iron protoporphyrin have important application value in biosensors, and the coordination complexes of nucleic acid quadruplexes and copper ions also exhibit Diels-Alder reactions chiral selectivity. After the specially designed DNA probe with nucleic acid quadruplex sequence recognizes the target (nucleic acid molecule, small biological molecule or protein molecule, etc.), the nucleic acid quadruplex can be released or exposed, and then coordinate with iron protoporphyrin to catalyze with H 2 o 2 It is a redox reaction of an oxidizing substrate, and when the reducing substrate is 2,2'-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): B01J31/22G01N33/50G01N33/68G01N33/94
CPCB01J31/183G01N33/9446G01N33/68G01N33/50B01J2531/025B01J2531/842B01J2531/72
Inventor丁宝全王振刚李韫哲
OwnerTHE NAT CENT FOR NANOSCI & TECH NCNST OF CHINA