A self-assembled nanomaterial and its preparation method and application
A nanomaterial and self-assembly technology, applied in the field of nanomaterials, achieves the effects of low price, high catalytic activity, and high catalytic kinetic parameters
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0061] This example prepares self-assembled nanomaterials by the following method
[0062] To 96 μL 50 mM Na 2 HPO 4 / NaH 2 PO 4 1 μL of 100 μM G-DNA, 2 μL of 1 mg / mL chitosan molecule (viscosity of 200 mPa·s, aqueous solution containing 1% acetic acid) and 1 μL of 100 μM hemin (dissolved in di Methyl sulfoxide), the sample addition time interval is 10s, followed by mixing at 25°C for 30min, and the reaction is to obtain the mimetic enzyme, that is, the self-assembled nanomaterial.
[0063] Wherein, the sequence of G-DNA is GGGTAGGGCGGGCGGG, which is purified by HPLC or PAGE.
[0064] Catalytic activity test
[0065] Add 1 μL of 100 mM tetramethylbenzidine (dissolved in DMSO) and 1 μL of 200 mM hydrogen peroxide solution to 100 μL of simulated enzyme solution in sequence. Intermediate product) as a function of time, through the molar extinction coefficient of the oxidation product of tetramethylbenzidine (39000M·cm -1 ), calculate H 2 o 2 The reduction rate and the ox...
Embodiment 2
[0068] This example prepares self-assembled nanomaterials by the following method
[0069] To 90 μL 50 mM K 2 HPO 4 / KH 2 PO 4 1 μL of 100 μM G-DNA, 8 μL of 2 mM / mL paromomycin sulfate aqueous solution and 1 μL of 100 μM hemin (dissolved in dimethyl sulfoxide) were sequentially added to the buffer solution (pH 7.0), and the sample addition time interval was 10 s , followed by mixing at 25° C. for 30 min, and reacted to obtain a mimetic enzyme, that is, a self-assembled nanomaterial.
[0070] Wherein, the sequence of G-DNA is GGTAGGCGGCGGTGGCGGCGGAGG, which is purified by HPLC or PAGE.
[0071] Catalytic activity test
[0072] Add 1 μL 100 mM phenol (dissolved in DMSO), 1 μL 200 mM 4-aminoantipyrine aqueous solution and 1 μL 200 mM hydrogen peroxide aqueous solution to 100 μL simulated enzyme solution successively, the sample addition time is 5 s, record the absorbance at a wavelength of 510 nm ( Indoxyl amino antipyrine dye) changes with time, by the molar extinction coe...
Embodiment 3
[0075] This example prepares self-assembled nanomaterials by the following method
[0076] To 90 μL of 50 mM MES / MES sodium salt buffer solution (pH 7.0, containing 50 mM NaCl), 1 μL of 200 μM G-DNA, 8 μL of 2 mM streptomycin aqueous solution and 1 μL of 100 μM manganese protoporphyrin (dissolved in dimethyl sulfone), the sample addition time interval was 10s, and then mixed at 20°C for 30 minutes, and the reaction was performed to obtain the mimetic enzyme, that is, the self-assembled nanomaterial.
[0077] Wherein, the sequence of G-DNA is GGTAGGCGGCGGTGGCGGCGGAGG, which is purified by HPLC or PAGE.
[0078] Catalytic activity test
[0079] Add 1 μL 100 mM phenol (dissolved in DMSO), 1 μL 200 mM 4-aminoantipyrine aqueous solution and 1 μL 200 mM hydrogen peroxide aqueous solution to 100 μL simulated enzyme solution successively, the sample addition time is 5 s, record the absorbance at a wavelength of 510 nm ( Indoxyl amino antipyrine dye) changes with time, by the molar e...
PUM
Property | Measurement | Unit |
---|---|---|
Viscosity | aaaaa | aaaaa |
Viscosity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap