Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rice salt stress resistance-related gene Os16 and coded protein and application thereof

A technology related to salt stress and resistance, applied in the field of rice genes, can solve problems such as the inability to use saline-alkali land, and achieve the effect of improving resistance and increasing grain production

Active Publication Date: 2020-01-17
XIAMEN UNIV
View PDF1 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At the same time, in arid and semi-arid areas, there are still large areas of unusable saline-alkali land

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice salt stress resistance-related gene Os16 and coded protein and application thereof
  • Rice salt stress resistance-related gene Os16 and coded protein and application thereof
  • Rice salt stress resistance-related gene Os16 and coded protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1: Obtaining the target fragment of the gene Os16 related to salt stress resistance

[0021] In the present invention, TP309 is used as a material to extract total RNA, and the RNA is reverse transcribed into cDNA by a reverse transcription kit. Using cDNA as a template, high-fidelity enzyme (Primerstar HS DNA Polymerase) can be used to amplify the target fragment. The primer sequences are:

[0022] OE-Os16 For:GTCAATTACTCCCCGAGTTTG

[0023] OE-Os16 Rev: CATGGCCGGAGATCGGCTGAG

[0024] The reaction system for PCR amplification is:

[0025]

[0026] The PCR amplification conditions were pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and 1 min at 72°C for 10 s, with a cycle number of 35 cycles; extension at 72°C for 5 min; and incubation at 4°C.

[0027] Recover the PCR product, and add A tail to the obtained PCR product. A tailing was done using Easytaq DNA Polymerase. No need to add primers, just incubate a...

Embodiment 2

[0029] Embodiment 2: Transformation of Agrobacterium to obtain transgenic rice plants

[0030] Step 1: Obtaining rice callus

[0031] 1. Select TP309 rice seeds and remove the hulls, put them in a 50mL centrifuge tube, and wash them with sterile water for 3 times, each time for 1 min;

[0032] 2. Disinfect the seeds with 75% ethanol three times, 1 min each time, and wash them with sterile water;

[0033] 3. Add 10% sodium hypochlorite solution, evacuate for 8 minutes, then place it on an inversion mixer at 30 n / min, and shake for 20 minutes;

[0034] 4. Wash the sodium hypochlorite solution on the surface of the rice seeds with sterile water, place the seeds on sterilized filter paper and dry them;

[0035] 5. Use tweezers to inoculate the seeds on the NBD medium, and inoculate about 13 rice seeds per plate. After culturing for 21 days in the dark, perform bud pinch treatment. When pinching buds, pay attention to completely pinch off the coleoptile, roots, etc., leaving only...

Embodiment 3

[0061] Example 3: Analysis of Salt Stress Resistance of Overexpressed Transgenic Plants

[0062] Firstly, TP309 was used for salt stress treatment to analyze the response of Os16. The specific process is as follows: the shelled TP309 rice seeds are sterilized by the above-mentioned method, and then sowed in solid 1 / 2MS medium. After the seedlings germinate, remove the tissue culture bottle after the main root grows, transfer to the black culture box, and carry out hydroponic culture in 1 / 2MS medium. When the rice seedlings grow to 21 days, the seedlings with the same growth state are selected for treatment, and the liquid 1 / 2MS (containing 200mM NaCl) is used for hydroponics during the treatment. Samples were taken at 0h before treatment as the control group, and then samples were taken at 1h, 3h, 6h, 12h, and 24h respectively, and the sampling repetition at each time point was three biological repetitions. Quick freeze in liquid nitrogen. Then transfer to -80°C freezer for...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to rice genes, in particular to a rice salt stress resistance-related gene Os16 and a coded protein and application thereof. The rice salt stress resistance-related gene Os16 isprovided. The rice salt stress resistance-related gene Os16 coded protein is provided. The rice salt stress resistance related gene Os16 can be used for improving the resistance of rice to salt stressand cultivating rice with enhanced salt stress resistance. An over-expression vector of the rice salt stress resistance-related gene Os16 is constructed and transformed to rice, and the rice with enhanced salt stress resistance is obtained by screening. An over-expressed transgenic plant with the gene can obviously improve the resistance of rice to salt stress. An important way for cultivating rice with enhanced salt stress resistance is provided. The cultivation of rice with enhanced salt stress resistance in agricultural production has important significance for energy saving and water saving, utilization of saline-alkaline land, increase of grain yield and the like.

Description

technical field [0001] The present invention relates to rice genes, in particular to the application of the rice salt resistance-related gene LOC_Os03g16460 (abbreviated as Os16) and its encoded protein. [0002] technical background [0003] Rice is one of the main food crops in the world, and it can also be used as a model plant in botany research. Studying the molecular biological mechanism of rice growth and development in various stages and the regulation of adversity stress will not only help to understand the growth and development mechanism of rice, but also have important significance for improving the stress resistance of rice and ensuring the yield of rice. [0004] With a large population in our country, food security is of paramount importance. Although my country has a vast territory and a large land area, the per capita arable land area is insufficient, which is one of the important factors affecting my country's food security. At the same time, in arid and s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00A01H6/46
CPCC07K14/415C12N15/8273
Inventor 陈亮赵立明崔玉超李燕郑锡军李秀郭小玲
Owner XIAMEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com