Beta-agarose, and application thereof in quantitative detection of agar
A technique for quantitative detection of agarase, which is applied in the field of biotechnology and biochemical detection, and can solve the problems of poor accuracy, cumbersome operation, time-consuming and laborious, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1: Cloning, expression and acquisition of β-agarase Aga16_Wa in Escherichia coli
[0043] Wenyingzhuangia aestuarii OF219 was cultured in 2216E medium until the end of the logarithm and the whole genome DNA was extracted. The upstream and downstream primers (5'-GACTGGTTCCAATTGACAAGC; 5'-GACACCTCGAGCTATTGATATACTCTTACATAATCTATTTC) were designed according to the target gene, and the whole genome was used as a template for PCR. The PCR reaction conditions were: : 95°C for 3 minutes, 95°C for 20s, 42°C for 22s, 72°C for 60s, 22 cycles, and finally 72°C for 5 minutes to obtain the β-agarase Aga16_Wa gene fragment, which was connected to the pET-28a(+) vector to form a recombinant plasmid. The recombinant plasmids were introduced into BL21(DE3) competent cells to form recombinant strains. Positive clones were screened and expressed in LB medium containing ampicillin by isopropylthiogalactoside, the induction temperature was 17°C, and the induction time was 12h. Colle...
Embodiment 2
[0044] Example 2: Cloning, expression and acquisition of β-agarase Aga16_Wa in Bacillus subtilis
[0045] Culture Wenyingzhuangia aestuarii OF219 in 2216E medium until the end of logarithm and extract whole genome DNA, design upstream and downstream primers (5'-GGATGACTGGTTCCAATTGACAAGC; 5'- TAAGACACCTCGAGCTATTGATATACTCTTATCATAATCTATTTC) according to the target gene, and perform PCR using the whole genome as a template to obtain β-agar The carbohydrase Aga16_Wa gene fragment is connected to the pHT01 vector to form a recombinant plasmid. The recombinant plasmid was transformed into Bacillus subtilis competent cells, positive clones were screened and expressed in LB culture medium with isopropylthiogalactoside, the induction temperature was 37°C, and the induction time was 12h. The cells were collected by centrifugation, and a certain amount of 20mM Na was added 2 HPO 4 -NaH 2 PO 4 Suspend in the buffer solution, and then perform ultrasonic crushing in an ice-water bath (po...
Embodiment 3
[0047] Example 3: Cloning, expression and acquisition of β-agarase Aga16_Wa in Pichia pastoris
[0048] Cultivate Wenyingzhuangia aestuarii OF219 in 2216E medium until the end of the logarithm and extract the whole genome DNA, design upstream and downstream primers (5'-AGGTGACTGGTTCCAATTGACAAGC; 5'- CCGGACACCTCGAGCTATTGATATACTCTTATCATAATCTATTTC) according to the target gene, and use the whole genome as a template for PCR to obtain β-agar The carbohydrase Aga16_Wa gene fragment was connected to the pPIC9k vector to form a recombinant plasmid, which was added to Pichia pastoris GS115 competent cells to form recombinant cells; positive clones were selected and inoculated in YPD medium, cultured at 30°C for 20 hours, and then inoculated in BMGY culture culture medium at 30°C and 200rpm on a shaking table until OD600=2.0, collected the bacteria by centrifugation, discarded the supernatant, resuspended the pellet with BMMY medium, and induced culture with methanol at 200rpm at 29°C f...
PUM
Property | Measurement | Unit |
---|---|---|
concentration | aaaaa | aaaaa |
concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap