Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Beta-agarose, and application thereof in quantitative detection of agar

A technique for quantitative detection of agarase, which is applied in the field of biotechnology and biochemical detection, and can solve the problems of poor accuracy, cumbersome operation, time-consuming and laborious, etc.

Active Publication Date: 2020-04-14
OCEAN UNIV OF CHINA
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The technical problem to be solved in the present invention is that the commonly used agar quantitative detection methods are phenol-sulfuric acid method and high performance liquid chromatography, and these two methods have the problems of poor accuracy and complicated operation, time-consuming and labor-intensive respectively

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Beta-agarose, and application thereof in quantitative detection of agar
  • Beta-agarose, and application thereof in quantitative detection of agar
  • Beta-agarose, and application thereof in quantitative detection of agar

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1: Cloning, expression and acquisition of β-agarase Aga16_Wa in Escherichia coli

[0043] Wenyingzhuangia aestuarii OF219 was cultured in 2216E medium until the end of the logarithm and the whole genome DNA was extracted. The upstream and downstream primers (5'-GACTGGTTCCAATTGACAAGC; 5'-GACACCTCGAGCTATTGATATACTCTTACATAATCTATTTC) were designed according to the target gene, and the whole genome was used as a template for PCR. The PCR reaction conditions were: : 95°C for 3 minutes, 95°C for 20s, 42°C for 22s, 72°C for 60s, 22 cycles, and finally 72°C for 5 minutes to obtain the β-agarase Aga16_Wa gene fragment, which was connected to the pET-28a(+) vector to form a recombinant plasmid. The recombinant plasmids were introduced into BL21(DE3) competent cells to form recombinant strains. Positive clones were screened and expressed in LB medium containing ampicillin by isopropylthiogalactoside, the induction temperature was 17°C, and the induction time was 12h. Colle...

Embodiment 2

[0044] Example 2: Cloning, expression and acquisition of β-agarase Aga16_Wa in Bacillus subtilis

[0045] Culture Wenyingzhuangia aestuarii OF219 in 2216E medium until the end of logarithm and extract whole genome DNA, design upstream and downstream primers (5'-GGATGACTGGTTCCAATTGACAAGC; 5'- TAAGACACCTCGAGCTATTGATATACTCTTATCATAATCTATTTC) according to the target gene, and perform PCR using the whole genome as a template to obtain β-agar The carbohydrase Aga16_Wa gene fragment is connected to the pHT01 vector to form a recombinant plasmid. The recombinant plasmid was transformed into Bacillus subtilis competent cells, positive clones were screened and expressed in LB culture medium with isopropylthiogalactoside, the induction temperature was 37°C, and the induction time was 12h. The cells were collected by centrifugation, and a certain amount of 20mM Na was added 2 HPO 4 -NaH 2 PO 4 Suspend in the buffer solution, and then perform ultrasonic crushing in an ice-water bath (po...

Embodiment 3

[0047] Example 3: Cloning, expression and acquisition of β-agarase Aga16_Wa in Pichia pastoris

[0048] Cultivate Wenyingzhuangia aestuarii OF219 in 2216E medium until the end of the logarithm and extract the whole genome DNA, design upstream and downstream primers (5'-AGGTGACTGGTTCCAATTGACAAGC; 5'- CCGGACACCTCGAGCTATTGATATACTCTTATCATAATCTATTTC) according to the target gene, and use the whole genome as a template for PCR to obtain β-agar The carbohydrase Aga16_Wa gene fragment was connected to the pPIC9k vector to form a recombinant plasmid, which was added to Pichia pastoris GS115 competent cells to form recombinant cells; positive clones were selected and inoculated in YPD medium, cultured at 30°C for 20 hours, and then inoculated in BMGY culture culture medium at 30°C and 200rpm on a shaking table until OD600=2.0, collected the bacteria by centrifugation, discarded the supernatant, resuspended the pellet with BMMY medium, and induced culture with methanol at 200rpm at 29°C f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention relates to the technical field of biotechnology and biochemical detection, and especially relates to a beta-agarose, and anapplication thereof in quantitative detection of agar. The enzyme has a novel amino acid sequence and good enzymatic properties, and the amino acid sequence of the enzyme is represented by SEQ ID NO. 1. The invention discloses a kit for detecting the agar contentby using beta-agarose Aga16_WA. The kit comprises a reagent A, a reagent B, a reagent C and a calibrator, wherein the reagent A comprises the beta-agarose Aga16_WA and a stabilizer. The kit is good in linear range and high in accuracy, and can be promoted and used in the market.

Description

technical field [0001] The invention relates to the technical field of biotechnology and biochemical detection, in particular to a β-agarase and its application in agar quantitative detection. Background technique [0002] Agar is a kind of hydrophilic colloid extracted from red algae, mainly composed of β-d-galactose and 3,6-endo-l-galactose through β-1,4 glycosidic bonds and α-1,3 It is formed by cross-linking glycosidic bonds. It is one of the most widely used seaweed gels in the world. Because of its good gelatinity and food safety, it is widely used in food industry, pharmaceutical industry, daily chemical industry, and bioengineering. And many other aspects. In the food industry, agar, as an important food additive, can be used in foods such as jelly, dairy products, ice cream, canned food and meat products. In the medical field, agar can be used as a direct medicine for chronic constipation, high cholesterol and other diseases. agent. As a kind of dietary fiber, ag...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/38C12N15/56C12Q1/40
CPCC12N9/2468C12Y302/01081C12Q1/40G01N2333/938
Inventor 常耀光陈广宁薛长湖申晶晶张玉莹石菲菲薛勇张恬恬
Owner OCEAN UNIV OF CHINA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com